Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
cpsf-2(gk5852[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051450 | Caenorhabditis elegans | cpsf-2(gk5852[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ V. | Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 3727 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GGTTTCGTCACGTAAATTTAGTGAGATCCT. Right flanking sequence: GTGAAAGCACCTTCCATTTGGAAGACTCCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00017313(cpsf-2) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00017313(cpsf-2) | WB-STRAIN:WBStrain00051450 | WormBase (WB) | WB | unknown | 2026-07-25 10:27:31 | 0 | ||||
|
nep-8(gk5859[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051456 | Caenorhabditis elegans | nep-8(gk5859[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. | Homozygous viable. Deletion of 2935 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAGAAAGTGAAAGAGAAGCTCTCTAGGCCT. Right flanking sequence: aggttcatccggcgacgacaaaaaatctaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00017553(nep-8) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00017553(nep-8) | WB-STRAIN:WBStrain00051456 | WormBase (WB) | WB | unknown | 2026-07-25 10:27:32 | 0 | ||||
|
rpb-11(gk5858[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051455 | Caenorhabditis elegans | rpb-11(gk5858[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. | Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 413 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: ATCATTTTTGCTTCTCGACGACAAGAAATT. Right flanking sequence: AACTGATTTTTCACTTTTTCCTTACTGATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00012187(rpb-11) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00012187(rpb-11) | WB-STRAIN:WBStrain00051455 | WormBase (WB) | WB | unknown | 2026-07-25 10:27:36 | 0 | ||||
|
best-24(gk5857[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051454 | Caenorhabditis elegans | best-24(gk5857[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. | Homozygous viable. Deletion of 3283 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TACAACTTAGCAGTATCCACTTCAAAACCG. Right flanking sequence: GAGAAACTACCCGATCCACCCGACCACAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00022797(best-24) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00022797(best-24) | WB-STRAIN:WBStrain00051454 | WormBase (WB) | WB | unknown | 2026-07-25 10:27:32 | 0 | ||||
|
Y71G12B.13(gk5855[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051453 | Caenorhabditis elegans | Y71G12B.13(gk5855[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. | Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 5445 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CACTGCAACAATCGCAATTTTCAGACAATT. Right flanking sequence: CGGAGCCTGTGCAATTCCATGTGGGAAATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00051453 | WormBase (WB) | WB | unknown | 2026-07-25 10:27:32 | 0 | ||||
|
grd-4(gk5861[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051458 | Caenorhabditis elegans | grd-4(gk5861[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. | Homozygous viable. Deletion of 890 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: gcaatacaacgaagtcatctaaagtgttca. Right flanking sequence: tgtgtgtttttgagaggataaaaagaaaca. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00001693(grd-4)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00001693(grd-4), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00051458 | WormBase (WB) | WB | unknown | 2026-07-25 10:27:36 | 0 | ||||
|
C50F2.2(gk5846[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051444 | Caenorhabditis elegans | C50F2.2(gk5846[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. | Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 4481 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TACCATCAGTTCATGAGAATGCCTACCAAG. Right flanking sequence: ACTGGAATTATGGCACAGATTATGAGGAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00051444 | WormBase (WB) | WB | unknown | 2026-07-25 10:27:31 | 0 | ||||
|
taf-2(gk5844[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051442 | Caenorhabditis elegans | taf-2(gk5844[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. | Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 8143 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CGCCTCGTATCCACTATTATGCCACTGTGA. Right flanking sequence: CGTTCAGCGTCACTTTGCTCGCCGAGCCCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006383(taf-2)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006383(taf-2), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00051442 | WormBase (WB) | WB | unknown | 2026-07-25 10:27:31 | 0 | ||||
|
Y65B4A.8(gk5849[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051447 | Caenorhabditis elegans | Y65B4A.8(gk5849[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. | Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 3386 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GACGGTCCACGTTTCGGCGAGCGTTTTGTG. Right flanking sequence: CGGCTGCGCGTCTCTATTTCACACACTGTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00051447 | WormBase (WB) | WB | unknown | 2026-07-25 10:27:31 | 0 | ||||
|
ints-2(gk5848[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051446 | Caenorhabditis elegans | ints-2(gk5848[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ V. | Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 5928 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GGGAAAGAAAGAAAAATTACTTCGAGATTG. Right flanking sequence: TGGAATGTTGGCTGGAGATCCACGACATGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00013877(ints-2) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00013877(ints-2) | WB-STRAIN:WBStrain00051446 | WormBase (WB) | WB | unknown | 2026-07-25 10:27:35 | 0 | ||||
|
vha-20(gk5840[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051438 | Caenorhabditis elegans | vha-20(gk5840[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ X. | Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1452 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTAGACGGTTATCAAGTTTTTATGAAACCA. Right flanking sequence: AACTTCATCCTGAAATTGATTGATTGAGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00010993(vha-20) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00010993(vha-20) | WB-STRAIN:WBStrain00051438 | WormBase (WB) | WB | unknown | 2026-07-25 10:27:31 | 0 | ||||
|
mir-47(umn55[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR LoX511I + Lox2272])I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051621 | Caenorhabditis elegans | mir-47(umn55[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR LoX511I + Lox2272])I. | mir-47 pre-miRNA deletion allele in which mir-47 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.] | WBGene00003275(mir-47)|WBGene00003514(myo-2)|WBGene00005016(sqt-1) | WBGene00003275(mir-47), WBGene00003514(myo-2), WBGene00005016(sqt-1) | WB-STRAIN:WBStrain00051621 | WormBase (WB) | WB | unknown | 2026-07-25 10:27:34 | 0 | ||||
|
mir-1818(umn54[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR LoX511I + Lox2272])I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051620 | Caenorhabditis elegans | mir-1818(umn54[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR LoX511I + Lox2272])I. | mir-1818 pre-miRNA deletion allele in which mir-1818 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.] | WBGene00003514(myo-2)|WBGene00005016(sqt-1)|WBGene00077715(mir-1818) | WBGene00003514(myo-2), WBGene00005016(sqt-1), WBGene00077715(mir-1818) | WB-STRAIN:WBStrain00051620 | WormBase (WB) | WB | unknown | 2026-07-25 10:27:37 | 0 | ||||
|
lea-1(cp423[myo-2p::GFP::myo-2 3'UTR]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051748 | Caenorhabditis elegans | lea-1(cp423[myo-2p::GFP::myo-2 3'UTR]) V. | Null allele of lea-1. lea-1 gene replaced with myo-2p::GFP reporter. cp423 mutants can be identified by GFP expression in pharynx. Reference: Hibshman JD & Goldstein B. BMC Biol. 2021 Dec 14;19(1):263. doi: 10.1186/s12915-021-01176-0. PMID: 34903234 | WBGene00002263(lea-1)|WBGene00003514(myo-2) | WBGene00002263(lea-1), WBGene00003514(myo-2) | WB-STRAIN:WBStrain00051748 | WormBase (WB) | WB | unknown | 2026-07-25 10:27:35 | 0 | ||||
|
T13C5.10(ve753[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051892 | Caenorhabditis elegans | T13C5.10(ve753[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. | Homozygous viable. Deletion of 1497 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gtcacgtaaaattttcaaaatggttgacca ; Right flanking sequence: AGGATAAtaaaaaatcgtattttaaatgct. sgRNA #1: tatgtacacctgccccaaaa; sgRNA #2: ACGTGCCAATCAGTAGTGTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00051892 | WormBase (WB) | WB | unknown | 2026-07-25 10:27:37 | 0 | ||||
|
+/nT1[umnIs49] IV; F53F4.11(ve761[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051896 | Caenorhabditis elegans | +/nT1[umnIs49] IV; F53F4.11(ve761[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. | Made_by: RG KO Group|"umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous early larval lethal. Deletion of 1620 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate dead larvae (ve761 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: CATGCACAGTTGGGAACAGTACAGACTGAT ; Right flanking sequence: AGGAGCAACTGACTTCACAACCTGCAGCTC. sgRNA #1: CGGTATCTTCCTTGAGAACA; sgRNA #2: TTCTTCGCAACTTCAACTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00051896 | WormBase (WB) | WB | unknown | 2026-07-25 10:27:39 | 0 | ||||
|
tmed-3(ve760[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051895 | Caenorhabditis elegans | tmed-3(ve760[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. | Homozygous viable. Deletion of 725 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttgaaaatcgtagaaactgtaataatttga ; Right flanking sequence: tcctccctttgatacatagcataagaatat. sgRNA #1: taatttcagGTTGTTACTGG; sgRNA #2: aaaggggcaaaacaactgac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00019003(tmed-3) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00019003(tmed-3) | WB-STRAIN:WBStrain00051895 | WormBase (WB) | WB | unknown | 2026-07-25 10:27:37 | 0 | ||||
|
F35H12.5(ve755[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051893 | Caenorhabditis elegans | F35H12.5(ve755[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. | Homozygous viable. Deletion of 1604 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tcagATGTTTTCTTCACGTCATATTTTATC ; Right flanking sequence: GATTCTATTTTTGATGCTGACAAAGAAGTC. sgRNA #1: AAACGTTCGTCCAATAATAA; sgRNA #2: CACAACTTCTACAATAAACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00051893 | WormBase (WB) | WB | unknown | 2026-07-25 10:27:39 | 0 | ||||
|
dxbp-1(gk5666[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051898 | Caenorhabditis elegans | dxbp-1(gk5666[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. | Made_by: Morgan Zaic|"umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5666 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VC4596 and CGC92. gk5666 is a 2234 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGTGGGCGGCAAAATATTTTTTCCGCCAAACCGGCAAATTGCCGGAATTGAAAATTTCCG. Right flanking sequence: TTCGGAAGTTAAGTGGCATTTGAAGCCGTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00000254(bli-4)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00013128(dxbp-1) | WBGene00000254(bli-4), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00013128(dxbp-1) | WB-STRAIN:WBStrain00051898 | WormBase (WB) | WB | unknown | 2026-07-25 10:27:37 | 0 | ||||
|
+/mT1 [umnIs52] II; C16C10.2(gk5524[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mT1 [dpy-10(e128)] III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00051930 | Caenorhabditis elegans | +/mT1 [umnIs52] II; C16C10.2(gk5524[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mT1 [dpy-10(e128)] III. | Made_by: Morgan Zaic|"umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5524 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4449 and CGC66. gk5524 is a 957 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TAACTACTTCTTTCGTTCATAGGTCCATTT. Right flanking sequence: CGAGGACATGGCTGGCTGAAAATAATTTTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00001072(dpy-10)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00001072(dpy-10), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00051930 | WormBase (WB) | WB | unknown | 2026-07-25 10:27:38 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
