Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00033910
Source Database: WormBase (WB)
Affected Genes: WBGene00001076(dpy-17)|WBGene00003401(mpk-1)|WBGene00006811(unc-79)
Genomic Alteration: WBGene00001076(dpy-17), WBGene00003401(mpk-1), WBGene00006811(unc-79)
Availability: available
Source References: PMID:34040027
Synonyms: mpk-1(ga117)/dpy-17(e164) unc-79(e1068) III.
Alternate IDs: WB-STRAIN:SD378, CGC_SD378
Notes: Heterozygotes are WT and segregate WT, Sterile Vuls, and Dpy Uncs.|"WBStrain mapped, WBPaper00061444 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00033910 Copy
http://www.wormbase.org/db/get?name=WBStrain00033961
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: ccIs4251 I; gaIs245.
Alternate IDs: WB-STRAIN:SD1453, CGC_SD1453
Notes: ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. gaIs245 [col-34p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
Proper citation: RRID:WB-STRAIN:WBStrain00033961 Copy
http://www.wormbase.org/db/get?name=WBStrain00033962
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: ccIs4251 I; stIs10117.
Alternate IDs: WB-STRAIN:SD1454, CGC_SD1454
Notes: ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10117 [hsp-3p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009) 139(6).
Proper citation: RRID:WB-STRAIN:WBStrain00033962 Copy
http://www.wormbase.org/db/get?name=WBStrain00033975
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: ccIs4251 I; stIs10166.
Alternate IDs: WB-STRAIN:SD1546, CGC_SD1546
Notes: ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10166 [dpy-7p::HIS-24::mCherry + unc-119(+)]. Reference: Liu, X, et al., Cell (2009).
Proper citation: RRID:WB-STRAIN:WBStrain00033975 Copy
http://www.wormbase.org/db/get?name=WBStrain00034081
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: foxSi37 I.
Alternate IDs: WB-STRAIN:SJZ204, CGC_SJZ204
Notes: foxSi37 [ges-1p::tomm-20::mKate2::HA::tbb-2 3' UTR] I. Transgene inserted into oxTi185. Superficially wild-type. Gut-specific expression of reporter construct. This strain is part of toolkit to affinity purify mitochondria from specific tissues. Reference: Ahier A, et al. Nat Cell Biol. 2018 Mar;20(3):352-360.
Proper citation: RRID:WB-STRAIN:WBStrain00034081 Copy
http://www.wormbase.org/db/get?name=WBStrain00034088
Source Database: WormBase (WB)
Affected Genes: WBGene00003168(mec-4)
Genomic Alteration: WBGene00003168(mec-4)
Availability: available
Source References: PMID:33659873, PMID:36774344
Synonyms: zdIs5 I.
Alternate IDs: WB-STRAIN:SK4005, CGC_SK4005
Notes: Mutagen:UV/TMP|"zdIs5 [mec-4p::GFP + lin-15(+)] I. mec-4::GFP is expressed in touch neurons."
Proper citation: RRID:WB-STRAIN:WBStrain00034088 Copy
http://www.wormbase.org/db/get?name=WBStrain00034062
Source Database: WormBase (WB)
Affected Genes: WBGene00002147(ire-1)
Genomic Alteration: WBGene00002147(ire-1)
Availability: available
Source References: PMID:37500972
Synonyms: ire-1(zc14) II; zcIs4 V.
Alternate IDs: WB-STRAIN:SJ30, CGC_SJ30
Notes: zcIs4 [hsp-4::GFP] V. Animals contain a missense mutation (G739R) in the kinase domain of ire-1. They are unable to induce hsp-4(BiP0 in response to tumincamycin, or heat shock.
Proper citation: RRID:WB-STRAIN:WBStrain00034062 Copy
http://www.wormbase.org/db/get?name=WBStrain00034065
Source Database: WormBase (WB)
Availability: available
Source References: PMID:32550360, PMID:31735670, PMID:32294300, PMID:32306217, PMID:32640191, PMID:32600387, PMID:33006972, PMID:32958476, PMID:33216250, PMID:33319173, PMID:33542359, PMID:33883621, PMID:34172445, PMID:34407398, PMID:34467850, PMID:35045336, PMID:35602005, PMID:36774344, PMID:37103980, PMID:37416472, PMID:37500972, PMID:37684042, PMID:38100354, PMID:38253120, PMID:38403745, PMID:38361361, PMID:38852157, PMID:38983916, PMID:39235964, PMID:39418305, PMID:39436952
Synonyms: zcIs4 [hsp-4::GFP]
Alternate IDs: WB-STRAIN:SJ4005, CGC_SJ4005
Notes: Generated from papers flagged positive during the last month for data type afp_strain/other_strain.|"Mutagen:Psoralen and UV"|"Mutagen:Psoralin and UV"|"Supplementary_genotype zcIs4 [Phsp-4GFP]"|"WBStrain mapped, WBPaper00059596 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00059950 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060638 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061409 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061527 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061562 added based on AFP_Strain data."|"WBStrain provided so WBPaper00059545 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060410 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060420 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061805 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061870 paper added based on AFP_Strain data."|"zcIs4 [hsp-4::GFP] V. The hsp-4::GFP reporter integrated within the cluster of LG V. Animals express low levels of GFP under basal conditions. However, expression in the gut and hypodermis can increase in response to tunicamycin treatment or heat shock."
Proper citation: RRID:WB-STRAIN:WBStrain00034065 Copy
http://www.wormbase.org/db/get?name=WBStrain00034066
Source Database: WormBase (WB)
Affected Genes: WBGene00002025(hsp-60)
Genomic Alteration: WBGene00002025(hsp-60)
Availability: available
Source References: PMID:31735670, PMID:33319173, PMID:33542359, PMID:34172445, PMID:34467850, PMID:35045336, PMID:36774344, PMID:39169052
Synonyms: zcIs9 V.
Alternate IDs: WB-STRAIN:SJ4058, CGC_SJ4058
Notes: Generated from papers flagged positive during the last month for data type afp_strain/other_strain.|"WBStrain mapped, WBPaper00061409 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061527 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061562 added based on AFP_Strain data."|"WBStrain provided so WBPaper00061870 paper added based on AFP_Strain data."|"zcIs9 [hsp-60::GFP + lin-15(+)]. Stable transgenic line with low basal GFP expression, mainly in the tail, observed from L1 to adult. Induced by perturbations of mitochondrial folding environment."
Proper citation: RRID:WB-STRAIN:WBStrain00034066 Copy
http://www.wormbase.org/db/get?name=WBStrain00034101
Source Database: WormBase (WB)
Affected Genes: WBGene00007117(spe-42)
Genomic Alteration: WBGene00007117(spe-42)
Availability: available
Source References: EMPTY
Synonyms: spe-42(tn1231) V/nT1 [unc-?(n754) let-? qIs50] (IV;V).
Alternate IDs: WB-STRAIN:SL1138, CGC_SL1138
Notes: Heterozygotes are Unc and express myo-2::GFP in the pharynx. spe-42(tn1231) homozygotes are non-Unc and non-GFP. spe-42(tn1231) produces <1 self progeny at 16C and no self progeny at 25C. The Spe defect can be rescued by WT sperm. Homozygous nT1[unc-?(n754) let-? qIs50] are embryonic lethal.
Proper citation: RRID:WB-STRAIN:WBStrain00034101 Copy
http://www.wormbase.org/db/get?name=WBStrain00034072
Source Database: WormBase (WB)
Affected Genes: WBGene00006726(ubl-5)
Genomic Alteration: WBGene00006726(ubl-5)
Availability: available
Source References: EMPTY
Synonyms: zcIs19.
Alternate IDs: WB-STRAIN:SJ4151, CGC_SJ4151
Notes: Mutagen:UV/TMP|"zcIs19 contains [ubl-5p::ubl-5::GFP]."
Proper citation: RRID:WB-STRAIN:WBStrain00034072 Copy
http://www.wormbase.org/db/get?name=WBStrain00034049
Source Database: WormBase (WB)
Affected Genes: WBGene00004323(rde-1)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00004323(rde-1), WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; rde-1(ne300) V; gaEx234.
Alternate IDs: WB-STRAIN:SD1963, CGC_SD1963
Notes: gaEx234 [elt-2p::elt-2::GFP + unc-119(+)]. Pick non-Unc to maintain. Long-lived. Overexpression of ELT-2. RNAi-resistant. Reference: Mann F, et al. PLoS.
Proper citation: RRID:WB-STRAIN:WBStrain00034049 Copy
http://www.wormbase.org/db/get?name=WBStrain00034104
Source Database: WormBase (WB)
Affected Genes: WBGene00004013(pha-4)|WBGene00004879(smg-1)
Genomic Alteration: WBGene00004013(pha-4), WBGene00004879(smg-1)
Availability: available
Source References: PMID:32302543
Synonyms: smg-1(cc546) I; pha-4(zu225) V.
Alternate IDs: WB-STRAIN:SM190, CGC_SM190
Notes: Dies at 15-20C with mostly dead embyros and a few dead larvae. Grows best at 24C. Survives at 25C, but worms look sick (often small and clear) and have very reduced brood sizes. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]|"Made_by: Mary Ellen Domeier"|"WBStrain mapped, WBPaper00059578 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00034104 Copy
http://www.wormbase.org/db/get?name=WBStrain00034248
Source Database: WormBase (WB)
Affected Genes: WBGene00018285(smk-1)
Genomic Alteration: WBGene00018285(smk-1)
Availability: available
Source References: PMID:7152245
Synonyms: smk-1(mn156) V.
Alternate IDs: WB-STRAIN:SP488, CGC_SP488
Notes: Extremely hypersensitive to UV, X and gamma irradiation. Some sensitivity to chronic MMS treatment.|"no longer available from the CGC."
Proper citation: RRID:WB-STRAIN:WBStrain00034248 Copy
http://www.wormbase.org/db/get?name=WBStrain00034250
Source Database: WormBase (WB)
Affected Genes: WBGene00000537(clk-2)
Genomic Alteration: WBGene00000537(clk-2)
Availability: available
Source References: PMID:7152245
Synonyms: clk-2(mn159) III.
Alternate IDs: WB-STRAIN:SP506, CGC_SP506
Notes: Hypersensitive to UV and X irradiation, to to MMS. Reduced brood size at 20C; sterile at 25C. Increased spontaneous mutability. Previously called rad-5.
Proper citation: RRID:WB-STRAIN:WBStrain00034250 Copy
http://www.wormbase.org/db/get?name=WBStrain00034210
Source Database: WormBase (WB)
Availability: available
Source References: PMID:32149606, PMID:33593818
Synonyms: 4n (tetraploid).
Alternate IDs: WB-STRAIN:SP346, CGC_SP346
Notes: TETRAPLOID 4A:4X PICK LARGE TO MAINTAIN|"WBStrain provided so WBPaper00061063 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00034210 Copy
http://www.wormbase.org/db/get?name=WBStrain00034401
Source Database: WormBase (WB)
Affected Genes: WBGene00003559(ncl-1)|WBGene00003886(osm-6)|WBGene00006772(unc-36)
Genomic Alteration: WBGene00003559(ncl-1), WBGene00003886(osm-6), WBGene00006772(unc-36)
Availability: available
Source References: PMID:37463209
Synonyms: ncl-1(e1865) unc-36(e251) III; osm-6(p811) V; mnIs17.
Alternate IDs: WB-STRAIN:SP2101, CGC_SP2101
Notes: mnIs17 [osm-6::GFP + unc-36(+)].
Proper citation: RRID:WB-STRAIN:WBStrain00034401 Copy
http://www.wormbase.org/db/get?name=WBStrain00034481
Source Database: WormBase (WB)
Affected Genes: WBGene00008263(ven-1)
Genomic Alteration: WBGene00008263(ven-1)
Availability: available
Source References: EMPTY
Synonyms: ven-1(nc28) LGV
Alternate IDs: WB-STRAIN:ST28, CGC_ST28
Notes: Made_by: Go Shioi|"Ventral cord displacement and detachment. Muscle attachment defects. Some larval lethality."
Proper citation: RRID:WB-STRAIN:WBStrain00034481 Copy
http://www.wormbase.org/db/get?name=WBStrain00034403
Source Database: WormBase (WB)
Affected Genes: WBGene00006366(sym-1)
Genomic Alteration: WBGene00006366(sym-1)
Availability: available
Source References: PMID:38177158
Synonyms: sym-1(mn601) X.
Alternate IDs: WB-STRAIN:SP2163, CGC_SP2163
Notes: Made_by:
Proper citation: RRID:WB-STRAIN:WBStrain00034403 Copy
http://www.wormbase.org/db/get?name=WBStrain00034405
Source Database: WormBase (WB)
Affected Genes: WBGene00006368(sym-3)
Genomic Alteration: WBGene00006368(sym-3)
Availability: available
Source References: EMPTY
Synonyms: sym-3(mn618) X.
Alternate IDs: WB-STRAIN:SP2231, CGC_SP2231
Notes: Made_by: R.K. Herman|"Wild type. Synthetically lethal with mec-8."
Proper citation: RRID:WB-STRAIN:WBStrain00034405 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
