Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00030334
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(tm4063) III; wgIs563.
Alternate IDs: WB-STRAIN:OP563, CGC_OP563
Notes: Made_by: DKV/RJT/PW|"Modern strain"|"wgIs563 [cebp-1::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (URL: www.modencode.org)."
Proper citation: RRID:WB-STRAIN:WBStrain00030334 Copy
http://www.wormbase.org/db/get?name=WBStrain00030557
Source Database: WormBase (WB)
Availability: available
Source References: PMID:37878696
Synonyms: ccTi1594 umnIs7 III.
Alternate IDs: WB-STRAIN:PD2218, CGC_PD2218
Notes: ccTi1594 [mex-5p::GFP::gpr-1::smu-1 3'UTR + Cbr-unc-119(+), III: 680195] III. umnIs7 [myo-2p::GFP + NeoR, III:9421936] III. GFP expression in germline and GFP expression in pharynx. High penetrance of non-Mendelian inheritance. Neomycin resistant. The GPR-1 overexpression transgene consistently confers a high penetrance of non-Mendelian inheritance; fluorescent markers allow tracking of Mendelian and non-Mendelian events. The genomic location of ccTi1594 is with respect to the WEBcel235 assembly.|"Supplementary_genotype ccTi1594 [mex-5p::GFP::gpr-1::smu-1 3'UTR + Cbr-unc-119(+), III: 680195] III. umnIs7 [myo-2p::GFP + NeoR, III:9421936] III"
Proper citation: RRID:WB-STRAIN:WBStrain00030557 Copy
http://www.wormbase.org/db/get?name=WBStrain00030555
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: ccTi1594 unc-119(ed3) III.
Alternate IDs: WB-STRAIN:PD1594, CGC_PD1594
Notes: ccTi1594 [mex-5p::GFP::gpr-1::smu-1 3'UTR + Cbr-unc-119(+), III: 680195] III. GFP expression in germline. Transgene rescues unc-119(ed3). Improved GPR-1 over-expression transgene appears to be stably expressed in the germline at a wide range of temperatures and does not require special handling. (unlike other GPR-1 overexpressing transgenes previously described in the literature). The GPR-1 overexpression transgene consistently confers a high penetrance of non-Mendelian inheritance. Neomycin resistant. The genomic location of ccTi1594 is with respect to the WEBcel235 assembly.|"Made_by: Christian Froekjaer Jensen"
Proper citation: RRID:WB-STRAIN:WBStrain00030555 Copy
http://www.wormbase.org/db/get?name=WBStrain00030556
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: PMID:38946472
Synonyms: ccTi1594 unc-119(ed3) III; hjSi20 IV.
Alternate IDs: WB-STRAIN:PD2217, CGC_PD2217
Notes: ccTi1594 [mex-5p::GFP::gpr-1::smu-1 3'UTR + Cbr-unc-119(+), III: 680195] III. hjSi20 [myo-2p::mCherry::unc-54 3'UTR] IV. GFP expression in germline. mCherry expression in pharynx. The ccTi1594 transgene rescues unc-119(ed3). High penetrance of non-Mendelian inheritance. The GPR-1 overexpression transgene consistently confers a high penetrance of non-Mendelian inheritance; fluorescent markers allow tracking of Mendelian and non-Mendelian events. The genomic location of ccTi1594 is with respect to the WEBcel235 assembly.
Proper citation: RRID:WB-STRAIN:WBStrain00030556 Copy
http://www.wormbase.org/db/get?name=WBStrain00030553
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33313486, PMID:33458604, PMID:33693840, PMID:34156835, PMID:37008729, PMID:36595469, PMID:37170380, PMID:37590248, PMID:37777524, PMID:38596360, PMID:38488606, PMID:38771761, PMID:39712935
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:PD1074
Notes: A defined and recently cloned population of animals derived from the original Bristol variant of C. elegans originally obtained by Brenner from E. Dougherty with no known history of mutagenesis. Brenners original population, called N2, was used as the basis for the vast majority of laboratory strains in use currently. No early frozen stock of the unmutagenized N2 population currently exists, but later stocks were available from several laboratories. PD1074 is a clonal population founded by picking a single worm of one such stock, VC3510. VC3510 in turn derives from a subpopulation of N2 described in the literature as VC2010. PD1074 is intended to be used as a wild type reference strain with the closely matched genome assembly of Yoshimura et al (ref) available on Wormbase as VC2010-1.0. (ENA study accession PRJEB28388; assembly accession GCA_900538205). We note that PD1074 is expected to be largely similar to most lab N2 strains, but that as a clonal isolate derived from N2, there will be some loci that will vary compared to any other particular N2 isolate. One such example is a partial deletion of the alh-2 locus in PD1074. Additional loci that were found to vary between the prior N2 reference genome (WormBase release WS264) and the VC2010-1.0 assembly are detailed in supplemental table 8 in Yoshimura et al (ref).|"A defined and recently cloned population of animals derived from the original Bristol variant of C. elegans originally obtained by Brenner from E. Dougherty with no known history of mutagenesis. Brenners original population, called N2, was used as the basis for the vast majority of laboratory strains in use currently. No early frozen stock of the unmutagenized N2 population currently exists, but later stocks were available from several laboratories. PD1074 is a clonal population founded by picking a single worm of one such stock, VC3510. VC3510 in turn derives from a subpopulation of N2 described in the literature as VC2010. PD1074 is intended to be used as a wild type reference strain with the closely matched genome assembly of Yoshimura, et al. (Genome Res. 2019 Jun;29(6):1009-1022) available on Wormbase as VC2010-1.0. (ENA study accession PRJEB28388; assembly accession GCA_900538205). We note that PD1074 is expected to be largely similar to most lab N2 strains, but that as a clonal isolate derived from N2, there will be some loci that will vary compared to any other particular N2 isolate. One such example is a partial deletion of the alh-2 locus in PD1074. Additional loci that were found to vary between the prior N2 reference genome (WormBase release WS264) and the VC2010-1.0 assembly are detailed in supplemental table 8 in Yoshimura, et al, (2019)."|"Added Wild_Isolate tag as genotype info suggesting that they were sampled from the wild."|"Made_by: Karen Artiles & Mark Edgley"|"no longer available from the CGC."|"Supplementary_genotype"|"WBStrain provided so WBPaper00061243 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00061573 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00030553 Copy
http://www.wormbase.org/db/get?name=WBStrain00030592
Source Database: WormBase (WB)
Affected Genes: WBGene00003514(myo-2)|WBGene00003983(pes-10)|WBGene00017698(F22B7.9)
Genomic Alteration: WBGene00003514(myo-2), WBGene00003983(pes-10), WBGene00017698(F22B7.9)
Availability: available
Source References: PMID:32434424, PMID:37067863
Synonyms: mIs10 V.
Alternate IDs: WB-STRAIN:PD4793, CGC_PD4793
Notes: mIs10 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] V. WT GFP phenotype, with expression in 4-cell embryos, pharyngeal muscle and gut. Strong GFP signal. Suppresses recombination between unc-60 and dpy-11. See WBG 15 #5 page 20.
Proper citation: RRID:WB-STRAIN:WBStrain00030592 Copy
http://www.wormbase.org/db/get?name=WBStrain00030574
Source Database: WormBase (WB)
Affected Genes: WBGene00001079(dpy-20)
Genomic Alteration: WBGene00001079(dpy-20)
Availability: available
Source References: PMID:9486653, PMID:31769755, PMID:33602504, PMID:33654835, PMID:37043428, PMID:37432924, PMID:38799035, PMID:39420966, PMID:39612872
Synonyms: ccIs4251 I; dpy-20(e1282) IV.
Alternate IDs: WB-STRAIN:PD4251, CGC_PD4251
Notes: ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. This strain produces GFP in all body wall muscles and vulval muscles, with a combination of mitochondrial and nuclear localization. ME0. Heterozygous males mate well. Integrated array (ccIs4251) contains 3 plasmids: pSAK2 (myo-3 promoter driving a nuclear-targeted GFP-LacZ fusion), pSAK4 (myo-3 promoter driving motochondrially targeted GFP), and a dpy-20 subclone. Array rescues dpy-20(e1282ts).|"WBStrain mapped, WBPaper00061072 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061110 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00030574 Copy
http://www.wormbase.org/db/get?name=WBStrain00030575
Source Database: WormBase (WB)
Affected Genes: WBGene00003376(mls-1)
Genomic Alteration: WBGene00003376(mls-1)
Availability: available
Source References: EMPTY
Synonyms: mls-1(cc569) III; ayIs2 IV.
Alternate IDs: WB-STRAIN:PD4285, CGC_PD4285
Notes: ayIs2 [egl-15p::GFP + dpy-20(+)] IV. Adult midbody GFP pattern in 8 vm-1 type muscles (instead of 4 as in WT). mls-1(o) converts uterine to vulval muscles.
Proper citation: RRID:WB-STRAIN:WBStrain00030575 Copy
http://www.wormbase.org/db/get?name=WBStrain00030587
Source Database: WormBase (WB)
Affected Genes: WBGene00001953(hlh-8)
Genomic Alteration: WBGene00001953(hlh-8)
Availability: available
Source References: PMID:37651423, PMID:37310364
Synonyms: ayIs6 X.
Alternate IDs: WB-STRAIN:PD4666, CGC_PD4666
Notes: ayIs6 [hlh-8::GFP fusion + dpy-20(+)]. GFP expression in M and undifferentiated cells of the M lineage. Strain might carry dpy-20(e1282) in background.|"Supplementary_genotype ayIs6 [hlh-8::GFP fusion + dpy-20(+)] X"
Proper citation: RRID:WB-STRAIN:WBStrain00030587 Copy
http://www.wormbase.org/db/get?name=WBStrain00030671
Source Database: WormBase (WB)
Affected Genes: WBGene00001995(hpl-1)
Genomic Alteration: WBGene00001995(hpl-1)
Availability: available
Source References: EMPTY
Synonyms: hpl-1(tm1624) X.
Alternate IDs: WB-STRAIN:PFR60, CGC_PFR60
Notes: Wild type phenotype.
Proper citation: RRID:WB-STRAIN:WBStrain00030671 Copy
http://www.wormbase.org/db/get?name=WBStrain00030609
Source Database: WormBase (WB)
Affected Genes: WBGene00004879(smg-1)
Genomic Alteration: WBGene00004879(smg-1)
Availability: available
Source References: PMID:31882874, PMID:32302543, PMID:37728486, PMID:37936921
Synonyms: smg-1(cc546) I.
Alternate IDs: WB-STRAIN:PD8120, CGC_PD8120
Notes: Made_by: Getz and Fire|"Reference WBPaper00058995 added based on published strain data identified by Textpresso literature search."|"Supplementary_genotype smg-1(cc546)"|"Supplementary_genotype smg-1(cc546) I"|"Temperature sensitive. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]"|"WBStrain mapped, WBPaper00059578 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00030609 Copy
http://www.wormbase.org/db/get?name=WBStrain00030634
Source Database: WormBase (WB)
Availability: available
Source References: PMID:32687264, PMID:33188857, PMID:38594249, PMID:39519157
Synonyms: feIs5 X.
Alternate IDs: WB-STRAIN:PE255, CGC_PE255
Notes: feIs5 [sur-5p::luciferase::GFP + rol-6(su1006)] X. Rollers. Strain is bioluminescent when provided with exogenous D-luciferin (potassium salt) due to sur-5 promoter driving expression of firefly (Photinus pyralis) luciferase (lacking the peroxisome tagging signal) fused in-frame to GFP(S65C). Pick animals with high levels of fluorescence to retain expression of luciferase transgene. This strain is for academic use only. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. References: Lagido C, et al. BMC Physiol. 2008 Apr 2;8:7. McLaggan D, et al. PLoS One. 2012;7(10):e46503. Lagido C, et al. Toxicol Sci. 2009 May;109(1):88-95.|"WBStrain mapped, WBPaper00059997 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00030634 Copy
http://www.wormbase.org/db/get?name=WBStrain00030632
Source Database: WormBase (WB)
Affected Genes: WBGene00000894(dab-1)
Genomic Alteration: WBGene00000894(dab-1)
Availability: available
Source References: EMPTY
Synonyms: dab-1(gk291) II; feEx43.
Alternate IDs: WB-STRAIN:PE219, CGC_PE219
Notes: feEx43 [dab-1::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. Reference: Holmes et al. J Cell Sci. 2007 Aug 1;120(Pt 15):2741-51.
Proper citation: RRID:WB-STRAIN:WBStrain00030632 Copy
http://www.wormbase.org/db/get?name=WBStrain00033888
Source Database: WormBase (WB)
Availability: available
Source References: PMID:31645459, PMID:37684042, PMID:37995185, PMID:38034351
Synonyms: tjIs54; tjIs57.
Alternate IDs: WB-STRAIN:SA250, CGC_SA250
Notes: Supplementary_genotype GFP-TBB-2; mCherry TBG-1; tjIs54 [pie-1p:GFP:tbb-2 + pie-1p:2xmCherry:tbg-1 + unc-119(+)]. tjIs57 [pie-1p:mCherry:his-48 + unc-119(+)]|"Supplementary_genotype jIs54[pie-1p::GFP::tbb-2 + pie-1p::2xmCherry::tbg-1 + unc-119(+)]; tjIs57[pie1p::mCherry::his-48 + unc119(+)]"|"Supplementary_genotype unc-119(ed3) III; tjIs54 [Ppie-1GFP::TBB-2 + Ppie-1 2xmCherry::TBG-1 + unc-119(+)]; tjIs57 [Ppie-1 mCherry::HIS-48 + unc-119(+)]"|"tjIs54 [pie-1p::GFP::tbb-2 + pie-1p::2xmCherry::tbg-1 + unc-119(+)]. tjIs57 [pie-1p::mCherry::his-48 + unc-119(+)]. Maintain at 25C to avoid transgene silencing. Reference: Toya M, et al. Methods Cell Biol. 2010;97:359-72."|"WBStrain provided so WBPaper00061495 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00033888 Copy
http://www.wormbase.org/db/get?name=WBStrain00033897
Source Database: WormBase (WB)
Affected Genes: WBGene00004010(pha-1)
Genomic Alteration: WBGene00004010(pha-1)
Availability: available
Source References: EMPTY
Synonyms: pha-1(e2123) III; denEx22.
Alternate IDs: WB-STRAIN:SAL144, CGC_SAL144
Notes: denEx22 [K08D8.5::GFP + pha-1(+)]. Maintain at >22 degrees. Reference: Alper S, et al. (2007) Mol Cell Biol 27:5544-53.
Proper citation: RRID:WB-STRAIN:WBStrain00033897 Copy
http://www.wormbase.org/db/get?name=WBStrain00033898
Source Database: WormBase (WB)
Affected Genes: WBGene00004010(pha-1)
Genomic Alteration: WBGene00004010(pha-1)
Availability: available
Source References: EMPTY
Synonyms: pha-1(e2123) III; denEx24.
Alternate IDs: WB-STRAIN:SAL146, CGC_SAL146
Notes: denEx24 [clec-85p::GFP + pha-1(+)]. Maintain at >22 degrees. Reference: Alper S, et al. (2007) Mol Cell Biol 27:5544-53.
Proper citation: RRID:WB-STRAIN:WBStrain00033898 Copy
http://www.wormbase.org/db/get?name=WBStrain00033899
Source Database: WormBase (WB)
Affected Genes: WBGene00004010(pha-1)
Genomic Alteration: WBGene00004010(pha-1)
Availability: available
Source References: EMPTY
Synonyms: pha-1(e2123) III; denEx26.
Alternate IDs: WB-STRAIN:SAL148, CGC_SAL148
Notes: denEx26 [F08G5.6::GFP + pha-1(+)]. Maintain at >22 degrees. Reference: Alper S, et al. (2007) Mol Cell Biol 27:5544-53.
Proper citation: RRID:WB-STRAIN:WBStrain00033899 Copy
http://www.wormbase.org/db/get?name=WBStrain00033876
Source Database: WormBase (WB)
Affected Genes: WBGene00022425(plst-1)
Genomic Alteration: WBGene00022425(plst-1)
Availability: unknown
Source References: PMID:28400443
Synonyms: plst-1(msn190[plst-1::gfp]) IV; zbIs2(pie-1::lifeACT::RFP).
Alternate IDs: WB-STRAIN:RZB217
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00033876 Copy
http://www.wormbase.org/db/get?name=WBStrain00033941
Source Database: WormBase (WB)
Availability: available
Source References: PMID:15605074
Synonyms: ccIs4251 I; stIs10079.
Alternate IDs: WB-STRAIN:SD1347, CGC_SD1347
Notes: ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. stIs10079 [unc-54p::his-24::mCherry::let-858 3' UTR + unc-119(+)]. Published in Liu, X., et al., Cell, 2009. 139(6).|"Growth temperature 20 degC"
Proper citation: RRID:WB-STRAIN:WBStrain00033941 Copy
http://www.wormbase.org/db/get?name=WBStrain00033903
Source Database: WormBase (WB)
Affected Genes: WBGene00015678(mcp-1)
Genomic Alteration: WBGene00015678(mcp-1)
Availability: available
Source References: EMPTY
Synonyms: mcp-1(tm2679) V.
Alternate IDs: WB-STRAIN:SCL1, CGC_SCL1
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00033903 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
