Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
DA467 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005464 | Caenorhabditis elegans | eat-6(ad467) V. | Abnormal feeding. Strong relaxation defective. NOTE: This strain is reportedly homozygous for an unknown X-linked unc mutation (10/31/2017).|"WBStrain provided so WBPaper00059550 paper added based on AFP_Strain data." | WBGene00001137(eat-6) | WBGene00001137(eat-6) | WB-STRAIN:WBStrain00005464 | WormBase (WB) | WB | available | PMID:8462849 PMID:27936181 PMID:31735173 PMID:32292107 |
WB-STRAIN:DA467, CGC_DA467 | WormBase | 2026-09-26 11:21:49 | 0 | ||
|
DA453 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00005461 | Caenorhabditis elegans | eat-2(ad453) II. | Eat. Scrawny. Slow pumping. | WBGene00001133(eat-2) | WBGene00001133(eat-2) | WB-STRAIN:WBStrain00005461 | WormBase (WB) | WB | available | WB-STRAIN:DA453, CGC_DA453 | WormBase | 2026-09-26 11:21:49 | 1 | |||
|
DA449 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005460 | Caenorhabditis elegans | eat-1(e2343) dpy-20(e1282) IV. | Thin, starved, healthy adults. Retain few eggs. Slow irregular pumping at 16, 20, 25C. Dpy. | WBGene00001079(dpy-20)|WBGene00044731(eat-1) | WBGene00001079(dpy-20), WBGene00044731(eat-1) | WB-STRAIN:WBStrain00005460 | WormBase (WB) | WB | available | PMID:8462849 | WB-STRAIN:DA449, CGC_DA449 | WormBase | 2026-09-26 11:21:49 | 0 | ||
|
DA438 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005458 | Caenorhabditis elegans | bli-4(e937) I; rol-6(e187) II; daf-2(e1368) vab-7(e1562) III; unc-31(e928) IV; dpy-11(e224) V; lon-2(e678) X. | Linkage mapping strain. Maintain at 15C. | WBGene00000254(bli-4)|WBGene00000898(daf-2)|WBGene00001073(dpy-11)|WBGene00003056(lon-2)|WBGene00004397(rol-6)|WBGene00006767(unc-31)|WBGene00006873(vab-7) | WBGene00000254(bli-4), WBGene00000898(daf-2), WBGene00001073(dpy-11), WBGene00003056(lon-2), WBGene00004397(rol-6), WBGene00006767(unc-31), WBGene00006873(vab-7) | WB-STRAIN:WBStrain00005458 | WormBase (WB) | WB | available | WB-STRAIN:DA438, CGC_DA438 | WormBase | 2026-09-26 11:21:49 | 0 | |||
|
DA443 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005459 | Caenorhabditis elegans | rol-3(e754) unc-42(e270) V. | Roller Unc. e754 is cold-sensitive: lethal at 15C. | WBGene00004395(rol-3)|WBGene00006778(unc-42) | WBGene00004395(rol-3), WBGene00006778(unc-42) | WB-STRAIN:WBStrain00005459 | WormBase (WB) | WB | available | WB-STRAIN:DA443, CGC_DA443 | WormBase | 2026-09-26 11:21:49 | 0 | |||
|
CZ24990 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005456 | Caenorhabditis elegans | unc-44(ju1412[unc-44::GFP]) IV. | Endogenous unc-44 locus tagged for UNC-44L::GFP expression. The long isoform of UNC-44 is specific to neuronal expression. Reference: Chen F, Chisholm AD, Jin Y. Development. 2017 Feb 15;144(4):698-707.|"Supplementary_genotype unc-44(ju1412[unc-44::GFP]) (IV)" | WBGene00006780(unc-44) | WBGene00006780(unc-44) | WB-STRAIN:WBStrain00005456 | WormBase (WB) | WB | available | PMID:37751746 | WB-STRAIN:CZ24990, CGC_CZ24990 | WormBase | 2026-09-26 11:21:49 | 0 | ||
|
CZ23281 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005454 | Caenorhabditis elegans | juEx7105. | juEx7105 [mec-4p::PH::miniSOG(Q103L) + mec-4p::mCherry + ttx-3::RFP]. Pick RFP+ to maintain. Expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator) in mechanosensory neurons. Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271. | WB-STRAIN:WBStrain00005454 | WormBase (WB) | WB | available | WB-STRAIN:CZ23281, CGC_CZ23281 | WormBase | 2026-09-26 11:21:49 | 0 | |||||
|
DA2155 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005596 | Caenorhabditis elegans | har-1(ad2155) III. | Hemiasterlin resistant. Maintain under normal conditions. Reference: Zubovych IO, et al. Mol Biol Cell. 2010 Mar 15;21(6):956-69. | WBGene00007630(har-1) | WBGene00007630(har-1) | WB-STRAIN:WBStrain00005596 | WormBase (WB) | WB | available | WB-STRAIN:DA2155, CGC_DA2155 | WormBase | 2026-09-26 11:21:51 | 0 | |||
|
DA2143 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005593 | Caenorhabditis elegans | egl-4(ks62) IV; adEx2143. | adEx2143 [tax-4p::pkg-1 + rol-6p::GFP]. Maintain by picking GFP+. pkg-1 is the new name of egl-4. Reference: You et al (2008) Cell Metab 7(3):249-57. | WBGene00001173(egl-4) | WBGene00001173(egl-4) | WB-STRAIN:WBStrain00005593 | WormBase (WB) | WB | available | WB-STRAIN:DA2143, CGC_DA2143 | WormBase | 2026-09-26 11:21:51 | 0 | |||
|
DA2100 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00005590 | Caenorhabditis elegans | ser-7(tm1325) X | Lack of 5HT stimulation of pumping. Primers GGCCTGCCTTCCTGACATGT, CGCGGATTCTCTATCAATAG, ATCCTG GAGCTGGCGAGTTA, GACTGTAAACGCGCAGAGTC. Mutation site 42634-42635 - GGGAANNAAAACCCTCCCTNNANNANNATNNGCANNCC - 43376-43377. 742 bp deletion + 38 bp insertion.|"Mutagen:UV/TMP"|"WBStrain mapped, WBPaper00060976 added based on AFP_Strain data."|"WBStrain provided so WBPaper00060405 paper added based on AFP_Strain data." | WBGene00004780(ser-7) | WBGene00004780(ser-7) | WB-STRAIN:WBStrain00005590 | WormBase (WB) | WB | available | PMID:33007049 PMID:38514005 PMID:39025433 |
WB-STRAIN:DA2100, CGC_DA2100 | WormBase | 2026-09-26 11:21:51 | 1 | ||
|
DA726 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005509 | Caenorhabditis elegans | unc-10(e102) eat-13(ad522) X. | Unc. Eat mutant. Slippery pharynx-Slight relaxation defect. | WBGene00001142(eat-13)|WBGene00006750(unc-10) | WBGene00001142(eat-13), WBGene00006750(unc-10) | WB-STRAIN:WBStrain00005509 | WormBase (WB) | WB | available | PMID:8462849 | WB-STRAIN:DA726, CGC_DA726 | WormBase | 2026-09-26 11:21:50 | 0 | ||
|
DA707 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005506 | Caenorhabditis elegans | eat-17(ad707) X. | Eat mutant. Stuffs corpus and isthmus. Abnormality in m6 and m7 contraction timing. Displays clumping behavior; isolated in an RC301 background, so it's likely to have the RC301 bor-1 mutation. | WBGene00020770(eat-17) | WBGene00020770(eat-17) | WB-STRAIN:WBStrain00005506 | WormBase (WB) | WB | available | PMID:8462849 | WB-STRAIN:DA707, CGC_DA707 | WormBase | 2026-09-26 11:21:50 | 0 | ||
|
DA698 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005504 | Caenorhabditis elegans | unc-36(ad698) III. | EMS - RC301 background|"Unc. Eat - slippery pharynx, slow pumping." | WBGene00006772(unc-36) | WBGene00006772(unc-36) | WB-STRAIN:WBStrain00005504 | WormBase (WB) | WB | available | PMID:38338915 | WB-STRAIN:DA698, CGC_DA698 | WormBase | 2026-09-26 11:21:50 | 0 | ||
|
DA686 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005502 | Caenorhabditis elegans | nDf16/qC1 [dpy-19(e1259) glp-1(q339)] III. | Heterozygotes are WT and segregate WT, DpySteriles and dead eggs. dpy-19(e1259) is temperature sensitive. Maintain by picking WT. [Checked 11/94 with sma-3 and nDf16 is present.]|"Mutagen:Gamma rays (nDf16)" | WBGene00001078(dpy-19)|WBGene00001609(glp-1) | WBGene00001078(dpy-19), WBGene00001609(glp-1) | WB-STRAIN:WBStrain00005502 | WormBase (WB) | WB | available | PMID:2401010 | WB-STRAIN:DA686, CGC_DA686 | WormBase | 2026-09-26 11:21:50 | 0 | ||
|
DA1774 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005587 | Caenorhabditis elegans | ser-3(ad1774) I. | Deletion of bp 433-1994 of K02F2.6.|"Made_by: T. Niacaris"|"Mutagen:UV/TMP" | WBGene00004778(ser-3) | WBGene00004778(ser-3) | WB-STRAIN:WBStrain00005587 | WormBase (WB) | WB | available | WB-STRAIN:DA1774, CGC_DA1774 | WormBase | 2026-09-26 11:21:51 | 0 | |||
|
DA820 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005519 | Caenorhabditis elegans | eat-18(ad820) I. | Semidominant Eat. pka eat-18. | WBGene00001147(eat-18) | WBGene00001147(eat-18) | WB-STRAIN:WBStrain00005519 | WormBase (WB) | WB | available | WB-STRAIN:DA820, CGC_DA820 | WormBase | 2026-09-26 11:21:50 | 0 | |||
|
DA819 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005518 | Caenorhabditis elegans | eat-4(ad819) III. | Abnormal feeding. | WBGene00001135(eat-4) | WBGene00001135(eat-4) | WB-STRAIN:WBStrain00005518 | WormBase (WB) | WB | available | PMID:8462849 | WB-STRAIN:DA819, CGC_DA819 | WormBase | 2026-09-26 11:21:50 | 0 | ||
|
DA792 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005516 | Caenorhabditis elegans | eat-6(ad792) V. | Eat. Relaxation defective. Lib. Cold sensitive. | WBGene00001137(eat-6) | WBGene00001137(eat-6) | WB-STRAIN:WBStrain00005516 | WormBase (WB) | WB | available | WB-STRAIN:DA792, CGC_DA792 | WormBase | 2026-09-26 11:21:50 | 0 | |||
|
DA734 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005511 | Caenorhabditis elegans | adDf538 unc-101(m1) I. | Grinder cannot come to full forward position. Protruding spicules in males; males don't mate. Unc. adDf538 previously called phm-2(ad538). | WBGene00006829(unc-101) | WBGene00006829(unc-101) | WB-STRAIN:WBStrain00005511 | WormBase (WB) | WB | available | PMID:8462849 | WB-STRAIN:DA734, CGC_DA734 | WormBase | 2026-09-26 11:21:50 | 0 | ||
|
DA2250 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00005599 | Caenorhabditis elegans | mgl-2(tm355) I; mgl-1(tm1811) X. | Superficially wild-type; multiple subtle phenotypes related to nutritional response. References: Kang C, You YJ, Avery L. Genes Dev. 2007 Sep 1;21(17):2161-71. Kang C, Avery L. Genes Dev. 2009 Jan 1;23(1):12-7. | WBGene00003232(mgl-1)|WBGene00003233(mgl-2) | WBGene00003232(mgl-1), WBGene00003233(mgl-2) | WB-STRAIN:WBStrain00005599 | WormBase (WB) | WB | available | PMID:38362034 | WB-STRAIN:DA2250, CGC_DA2250 | WormBase | 2026-09-26 11:21:51 | 6 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.