Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
DA538 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005479 | Caenorhabditis elegans | adDf538 I. | Grinder cannot come to full forward position. Protruding spicules in males; males don't mate. PKA phm-2(ad538). | WB-STRAIN:WBStrain00005479 | WormBase (WB) | WB | available | PMID:8462849 | WB-STRAIN:DA538, CGC_DA538 | WormBase | 2026-09-26 11:21:49 | 0 | ||||
|
DA631 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00005496 | Caenorhabditis elegans | eat-3(ad426) II; him-8(e1489) IV. | Abnormal feeding. Slow, irregular feeding. eat-3 exhibits strong maternal effect; dauers seldom recover; Him.|"WBStrain mapped, WBPaper00061409 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061527 added based on AFP_Strain data." | WBGene00001134(eat-3)|WBGene00001867(him-8) | WBGene00001134(eat-3), WBGene00001867(him-8) | WB-STRAIN:WBStrain00005496 | WormBase (WB) | WB | available | PMID:8462849 | WB-STRAIN:DA631, CGC_DA631 | WormBase | 2026-09-26 11:21:50 | 2 | ||
|
DA612 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005494 | Caenorhabditis elegans | bli-4(e937) adDf538 I. | Blistered. Grinder cannot come to full forward position. Protruding spicules in males; males don't mate. adDf538 previously called phm-2(ad538). | WBGene00000254(bli-4) | WBGene00000254(bli-4) | WB-STRAIN:WBStrain00005494 | WormBase (WB) | WB | available | WB-STRAIN:DA612, CGC_DA612 | WormBase | 2026-09-26 11:21:49 | 0 | |||
|
DA620 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005495 | Caenorhabditis elegans | eat-2(ad465) lin-7(e1413) unc-52(e444) II. | Abnormal feeding: slow, regular pumping. Vulvaless (incomplete penetrance). Unc. | WBGene00001133(eat-2)|WBGene00002996(lin-7)|WBGene00006787(unc-52) | WBGene00001133(eat-2), WBGene00002996(lin-7), WBGene00006787(unc-52) | WB-STRAIN:WBStrain00005495 | WormBase (WB) | WB | available | WB-STRAIN:DA620, CGC_DA620 | WormBase | 2026-09-26 11:21:49 | 0 | |||
|
DA609 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00005493 | Caenorhabditis elegans | npr-1(ad609) X. | Causes worms to aggregate (Bor). Social.|"Supplementary_genotype npr-1(ad609)"|"WBStrain mapped, WBPaper00061439 added based on AFP_Strain data."|"WBStrain provided so WBPaper00061436 paper added based on AFP_Strain data." | WBGene00003807(npr-1) | WBGene00003807(npr-1) | WB-STRAIN:WBStrain00005493 | WormBase (WB) | WB | available | PMID:18993077 PMID:34038721 PMID:37572357 PMID:38446031 |
WB-STRAIN:DA609, CGC_DA609 | WormBase | 2026-09-26 11:21:49 | 9 | ||
|
CZ5261 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005409 | Caenorhabditis elegans | juIs198 V. | juIs198 [unc-25p::YFP::rab-5 + ttx-3p::RFP] V. YFP-labeled RAB-5 synaptic vesicles in GABAergic motor neurons. Reference: Sann SB, Crane MM, Lu H, Jin Y. PLoS One. 2012;7(6):e37930.|"Mutagen:UV/TMP" | WB-STRAIN:WBStrain00005409 | WormBase (WB) | WB | available | PMID:37432924 | WB-STRAIN:CZ5261, CGC_CZ5261 | WormBase | 2026-09-26 11:21:48 | 0 | ||||
|
DA601 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005489 | Caenorhabditis elegans | eat-6(ad601) V. | Eat. Long pumps; slippery isthmus and corpus. | WBGene00001137(eat-6) | WBGene00001137(eat-6) | WB-STRAIN:WBStrain00005489 | WormBase (WB) | WB | available | WB-STRAIN:DA601, CGC_DA601 | WormBase | 2026-09-26 11:21:49 | 0 | |||
|
DA599 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005488 | Caenorhabditis elegans | eat-8(ad599) III. | Abnormal feeding. Brief, rare pumps. Slight coiler Unc. | WBGene00001139(eat-8) | WBGene00001139(eat-8) | WB-STRAIN:WBStrain00005488 | WormBase (WB) | WB | available | PMID:8462849 | WB-STRAIN:DA599, CGC_DA599 | WormBase | 2026-09-26 11:21:49 | 0 | ||
|
CZ9676 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00005418 | Caenorhabditis elegans | acr-2(n2595 n2420) X. | Intragenic suppression of n2420 gain of function; n2595 is a nonsense mutation of acr-2. G to A at residue 525, causing W175-STOP. (WT: CACGGAGATGTGACATGGGTCCCACCTGCAATGTT) (n2595: CACGGAGATGTGACATGAGTCCCACCTGCAATGTT). Reference: Jospin M, et al. PLoS Biol. 2009 Dec;7(12):e1000265.|"Made_by: Tammy Stawicki" | WBGene00000042(acr-2) | WBGene00000042(acr-2) | WB-STRAIN:WBStrain00005418 | WormBase (WB) | WB | available | WB-STRAIN:CZ9676, CGC_CZ9676 | WormBase | 2026-09-26 11:21:49 | 1 | |||
|
CZ7112 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005414 | Caenorhabditis elegans | lin-31(n301) vab-1(e2027) II. | Muv. | WBGene00003017(lin-31)|WBGene00006868(vab-1) | WBGene00003017(lin-31), WBGene00006868(vab-1) | WB-STRAIN:WBStrain00005414 | WormBase (WB) | WB | available | WB-STRAIN:CZ7112, CGC_CZ7112 | WormBase | 2026-09-26 11:21:48 | 0 | |||
|
CZ8332 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005415 | Caenorhabditis elegans | juIs223 IV. | juIs223 [ttr-39p::mCherry + ttx-3p::GFP] IV. Transcriptional reporter with ttr-39 promoter driving mCherry expression in DD and VD neurons. Reference: Jospin M, et al. PLoS Biol. 2009 Dec;7(12):e1000265. | WB-STRAIN:WBStrain00005415 | WormBase (WB) | WB | available | WB-STRAIN:CZ8332, CGC_CZ8332 | WormBase | 2026-09-26 11:21:48 | 0 | |||||
|
DA658 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005498 | Caenorhabditis elegans | lon-2(e678) npr-1(n1353) X. | Long. Clumps. npr-1 pka bor-1.|"Made_by: Davis/Faulkner" | WBGene00003056(lon-2)|WBGene00003807(npr-1) | WBGene00003056(lon-2), WBGene00003807(npr-1) | WB-STRAIN:WBStrain00005498 | WormBase (WB) | WB | available | PMID:9741632 | WB-STRAIN:DA658, CGC_DA658 | WormBase | 2026-09-26 11:21:50 | 0 | ||
|
CZ10175 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00005421 | Caenorhabditis elegans | zdIs5 I. | WBStrain provided so WBPaper00060426 paper added based on AFP_Strain data.|"zdIs5 [mec-4p::GFP + lin-15(+)] I. SK4005 was outcrossed 10x to produce this strain." | WB-STRAIN:WBStrain00005421 | WormBase (WB) | WB | available | PMID:31983639 PMID:38134228 PMID:38783998 PMID:39378880 PMID:39746999 |
WB-STRAIN:CZ10175, CGC_CZ10175 | WormBase | 2026-09-26 11:21:49 | 5 | ||||
|
CZ18550 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00005441 | Caenorhabditis elegans | juSi123 II; rpl-29(tm3555) IV. | juSi123 [rpl-29::GFP] II. Strong GFP signal allowing visualization of ribosomes. GFP inserted at C-terminus of RPL-29. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.|"Made_by: Ken Noma" | WBGene00004443(rpl-29) | WBGene00004443(rpl-29) | WB-STRAIN:WBStrain00005441 | WormBase (WB) | WB | available | WB-STRAIN:CZ18550, CGC_CZ18550 | WormBase | 2026-09-26 11:21:49 | 2 | |||
|
CZ18637 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005442 | Caenorhabditis elegans | juSi83 II; rps-18(ok3353) IV/nT1[qIs51] (IV;V). | juSi83 [GFP::rps-18 + Cbr-unc-119(+)] II. Homozygous lethal mutation balanced by GFP-marked translocation. Heterozygotes are WT GFP+ and segregate WT GFP+, Vul and dead eggs. Non-conditonal GFP-tagged ribosomes; array over-expressing N-terminally tagged rps-18 (small ribosomal subunit) partially rescues rps-18(ok3353) larval arrest (some animals will escape L1 arrest and develop to L3 stage). Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.|"Made_by: Ken Noma" | WBGene00004487(rps-18) | WBGene00004487(rps-18) | WB-STRAIN:WBStrain00005442 | WormBase (WB) | WB | available | WB-STRAIN:CZ18637, CGC_CZ18637 | WormBase | 2026-09-26 11:21:49 | 0 | |||
|
CZ13896 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005436 | Caenorhabditis elegans | juIs319. | juIs319 [col-19p::GCaMP3 + col-19p::tdTomato]. col-19p::GCaMP3 expression is induced by either laser or needle wounding. col-19 is an adult-specific collagen and is not expressed until the end of the L4 larval stage. Reference: Xu S & Chisholm AD. Curr Biol. 2011 Dec 6;21(23):1960-7. | WB-STRAIN:WBStrain00005436 | WormBase (WB) | WB | available | PMID:31995031 | WB-STRAIN:CZ13896, CGC_CZ13896 | WormBase | 2026-09-26 11:21:49 | 0 | ||||
|
CZ14748 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005437 | Caenorhabditis elegans | juIs352. | juIs352 [col-19p::GFP::moesin]. GFP::moesin expression labels F-actin by fusing GFP to sequences that encoded the C-terminal end of the sole Drosophila MER homolog, moesin. The F-actin ring (GFP::moesin) is induced upon needle wounding. Reference: Xu S & Chisholm AD. Curr Biol. 2011 Dec 6;21(23):1960-7. | WB-STRAIN:WBStrain00005437 | WormBase (WB) | WB | available | PMID:31995031 | WB-STRAIN:CZ14748, CGC_CZ14748 | WormBase | 2026-09-26 11:21:49 | 0 | ||||
|
CZ13799 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00005435 | Caenorhabditis elegans | juIs76 [unc-25p::GFP + lin-15(+)] II | juIs76 [unc-25p::GFP + lin-15(+)] II. GFP expression in GABAergic motor neurons. [NOTE: (10/11/2018) CZ13799 was sent as a replacement for CZ1200, which was found to carry background mutations affecting neuron morphology.] Derived by outcrossing CZ1200 to remove lin-15(n765) and unidentified background mutations. Reference (for original juIs76 strain): Huang X, et al. Neuron. 2002 May 16;34(4):563-76.|"Supplementary_genotype juIs76" | WB-STRAIN:WBStrain00005435 | WormBase (WB) | WB | available | PMID:34534446 PMID:37980357 PMID:38797871 |
WB-STRAIN:CZ13799, CGC_CZ13799 | WormBase | 2026-09-26 11:21:49 | 1 | ||||
|
CZ22703 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005451 | Caenorhabditis elegans | juEx6916. | juEx6916 [myo-3p::PH::miniSOG(Q103L) + myo-3p::mCherry + ttx-3::GFP]. Pick GFP+ to maintain. Expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator) in body wall muscles. Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271. | WB-STRAIN:WBStrain00005451 | WormBase (WB) | WB | available | WB-STRAIN:CZ22703, CGC_CZ22703 | WormBase | 2026-09-26 11:21:49 | 0 | |||||
|
CZ19297 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005444 | Caenorhabditis elegans | juSi94 II; rps-18(ok3353) juIs409 IV. | juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. juIs409 [rgef-1p::GFP1-10 + ttx-3p::RFP] IV. Pan-neuronal-specific expression of split GFP reporter allows visualization of ribosomes in neurons. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.|"Made_by: Ken Noma"|"Mutagen:UV/TMP" | WBGene00004487(rps-18) | WBGene00004487(rps-18) | WB-STRAIN:WBStrain00005444 | WormBase (WB) | WB | available | WB-STRAIN:CZ19297, CGC_CZ19297 | WormBase | 2026-09-26 11:21:49 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
