Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00036323
Source Database: WormBase (WB)
Affected Genes: WBGene00002008(hsp-4)
Genomic Alteration: WBGene00002008(hsp-4)
Availability: available
Source References: PMID:34407398, PMID:36924492
Synonyms: hsp-4(gk514) II.
Alternate IDs: WB-STRAIN:VC1099, CGC_VC1099
Notes: F43E2.8. Superficially wild type.|"Mutagen:UV/TMP"|"Supplementary_genotype hsp-4(gk514) II"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain provided so WBPaper00061805 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00036323 Copy
http://www.wormbase.org/db/get?name=WBStrain00036497
Source Database: WormBase (WB)
Affected Genes: WBGene00004884(smg-6)
Genomic Alteration: WBGene00004884(smg-6)
Availability: available
Source References: EMPTY
Synonyms: smg-6(ok1794) III.
Alternate IDs: WB-STRAIN:VC1305, CGC_VC1305
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y54F10AL.2. Superficially wild type. External left primer: TAGCTAGCCCATGTGCCTTT. External right primer: TTTTGCGATGTGAATCGTGT. Internal left primer: TTTTAGCCACACCATCCACA. Internal right primer: CCAAAAACATGGGAAAATCG. Internal WT amplicon: 3113 bp. Deletion size: 920 bp. Deletion left flank: CAATTAAAAATTTTTTTTCTTGATTTTCTA. Deletion right flank: AAAATTGTGTCTAGGGGTGAAAAATTGCGA."
Proper citation: RRID:WB-STRAIN:WBStrain00036497 Copy
http://www.wormbase.org/db/get?name=WBStrain00036424
Source Database: WormBase (WB)
Affected Genes: WBGene00002101(ins-18)
Genomic Alteration: WBGene00002101(ins-18)
Availability: available
Source References: EMPTY
Synonyms: ins-18(ok1672) I.
Alternate IDs: WB-STRAIN:VC1218, CGC_VC1218
Notes: T28B8.2. Superficially wild type. External left primer: TTCAGATTGCTCGAAAGGCT. External right primer: GCCATTGTATCCATCCCATC. Internal left primer: CGTCGCCACTATTCCAAAAT. Internal right primer: CGTATTTTGTGGGCGGTACT. Internal WT amplicon: 2143 bp. Deletion size: 940 bp. Deletion left flank: AAGCTGGTTTGTTTTCATGTTTGTAATACA. Deletion right flank: TTTGGCAATTGGCAATTATTTAATTCTTTT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036424 Copy
http://www.wormbase.org/db/get?name=WBStrain00036431
Source Database: WormBase (WB)
Affected Genes: WBGene00002222(klp-11)
Genomic Alteration: WBGene00002222(klp-11)
Availability: available
Source References: PMID:37463209, PMID:38302462
Synonyms: klp-11(tm324) IV.
Alternate IDs: WB-STRAIN:VC1228, CGC_VC1228
Notes: 331 bp deletion. T608 Stop. Flanking sequences: aaaatgagaaaaggaacaactgaattggac taatttttaaacacaaaacttactattgtt.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036431 Copy
http://www.wormbase.org/db/get?name=WBStrain00036435
Source Database: WormBase (WB)
Affected Genes: WBGene00003839(ocr-2)
Genomic Alteration: WBGene00003839(ocr-2)
Availability: available
Source References: PMID:36652499
Synonyms: ocr-2(ok1711) IV.
Alternate IDs: WB-STRAIN:VC1233, CGC_VC1233
Notes: T09A12.3. Superficially wild type. External left primer: TAGCATTTGTAAAACCCGGC. External right primer: AAAAACCCCCAATTTTCCTG. Internal left primer: CGAAAGCTTCAATGGGTGAT. Internal right primer: GGCTCCGAAAGCTTACCTCT. Internal WT amplicon: 2957 bp. Deletion size: 1512 bp.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036435 Copy
http://www.wormbase.org/db/get?name=WBStrain00036448
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00021636(pcaf-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00021636(pcaf-1)
Availability: available
Source References: EMPTY
Synonyms: pcaf-1(ok1690) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC1250, CGC_VC1250
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y47G6A.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1690 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGAAATCCCTTCGCACACT. External right primer: ATTGGCATTTTTCTAGCCGA. Internal left primer: GCGAAAAACAACGATTAGCC. Internal right primer: CTGGAACTTGGAAACTTGGG. Internal WT amplicon: 3142 bp. Deletion size: 1258 bp. Deletion left flank: CTACAGGAAGAGGAGAGTGGGCTCATTGAG. Deletion right flank: TTTGCCCATTTTTGCTAAAATTGAACCAAA. Insertion Sequence: CCCATTTTTGCCCATTTTTGCCCAT."
Proper citation: RRID:WB-STRAIN:WBStrain00036448 Copy
http://www.wormbase.org/db/get?name=WBStrain00036549
Source Database: WormBase (WB)
Affected Genes: WBGene00004466(rpn-10)
Genomic Alteration: WBGene00004466(rpn-10)
Availability: available
Source References: PMID:37355092
Synonyms: rpn-10(ok1865) I.
Alternate IDs: WB-STRAIN:VC1369, CGC_VC1369
Notes: B0205.3. Superficially wild type. External left primer: CTTTTTAAGCGGTGCGTCAT. External right primer: GCTCGATATTCCATCCGAAA. Internal left primer: TGGGTCTCTTCTCGCATCTC. Internal right primer: TGCACCAACAACTCCACATT. Internal WT amplicon: 2184 bp. Deletion size: 1166 bp. Deletion left flank: CAGAATCCGCGGCACCTCCATTTGCAGCAG. Deletion right flank: TATGAACTCTGTAGAATGTGAGAAATAAAA.|"Mutagen:UV/TMP"|"Supplementary_genotype (rpn-10(ok1865) I)"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036549 Copy
http://www.wormbase.org/db/get?name=WBStrain00036595
Source Database: WormBase (WB)
Affected Genes: WBGene00003056(lon-2)|WBGene00015391(sdha-1)
Genomic Alteration: WBGene00003056(lon-2), WBGene00015391(sdha-1)
Availability: available
Source References: EMPTY
Synonyms: +/szT1 [lon-2(e678)] I; sdha-1(ok1908)/szT1 X.
Alternate IDs: WB-STRAIN:VC1434, CGC_VC1434
Notes: C03G5.1. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1908 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AACGAAGGCAAACTGGTGAC. External right primer: CTACGAGCGGTTCATTTGGT. Internal left primer: AATAGGAGCGGACCTTTGGT. Internal right primer: GCAATTCCGCACGTTTATCT. Internal WT amplicon: 2954 bp. Deletion size: 1211 bp. Deletion left flank: GACGAAGCTCGGCAGTTGAGATGTCTCCCT. Deletion right flank: GCATTACAATTAAAATATTCTGATTAAGTT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036595 Copy
http://www.wormbase.org/db/get?name=WBStrain00036524
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00006915(vha-6)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00006915(vha-6)
Availability: available
Source References: EMPTY
Synonyms: vha-6(ok1825)/mIn1 [mIs14 dpy-10(e128)] II.
Alternate IDs: WB-STRAIN:VC1336, CGC_VC1336
Notes: Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"VW02B12L.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1825 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GAAGCAGAATGGCTCGAACT. External right primer: TCATCCATCATTCCAGAGCA. Internal left primer: GGAACTCGACCCAATGAAGA. Internal right primer: GGTGGCGGTCTGATATTGAT. Internal WT amplicon: 3301 bp. Deletion size: 982 bp. Deletion left flank: GGCTTGACGAGAAGCATAACTGGAACAGAT. Deletion right flank: GGAGCTGGATTAACTTCTCGATAGTTGGCA."
Proper citation: RRID:WB-STRAIN:WBStrain00036524 Copy
http://www.wormbase.org/db/get?name=WBStrain00036581
Source Database: WormBase (WB)
Affected Genes: WBGene00007799(nrx-1)
Genomic Alteration: WBGene00007799(nrx-1)
Availability: available
Source References: EMPTY
Synonyms: nrx-1(ok1649) V.
Alternate IDs: WB-STRAIN:VC1416, CGC_VC1416
Notes: C29A12.4. Mildly Unc. External left primer: CGGAAGCAAAGAAACCAAAG. External right primer: CTCTTGGCCAGATGTTCGAT. Internal left primer: TTATGCGGGAGATGAAAAGG. Internal right primer: GTTGAGCATTTGCAATCGAA. Internal WT amplicon: 3130 bp. Deletion size: 861 bp.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036581 Copy
http://www.wormbase.org/db/get?name=WBStrain00036502
Source Database: WormBase (WB)
Affected Genes: WBGene00000472(cey-1)
Genomic Alteration: WBGene00000472(cey-1)
Availability: available
Source References: PMID:39423228
Synonyms: cey-1(ok1805) II.
Alternate IDs: WB-STRAIN:VC1310, CGC_VC1310
Notes: F33A8.3. Superficially wild type. External left primer: CCGTTTCTCGAAAGTGCTTC. External right primer: TACACTGACCGCTGCTCATC. Internal left primer: AACCGGAGAAGGAGAAGCTC. Internal right primer: GGTCAGCTTACACACTCGCA. Internal WT amplicon: 2614 bp. Deletion size: 539 bp.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036502 Copy
http://www.wormbase.org/db/get?name=WBStrain00036563
Source Database: WormBase (WB)
Affected Genes: WBGene00007932(zip-5)
Genomic Alteration: WBGene00007932(zip-5)
Availability: available
Source References: EMPTY
Synonyms: zip-5(gk646) V.
Alternate IDs: WB-STRAIN:VC1392, CGC_VC1392
Notes: C34D1.5. External left primer: ATACGCGTGCTCTTTGTCCT. External right primer: CCACATCATGATCACTTCCG. Internal left primer: TTGTGGTTTGGTCCCACTTT. Internal right primer: CACCCAAATGTCACAAGACG. Internal WT amplicon: 2130 bp. Deletion size: 2008 bp. Deletion left flank: ACGATGTTACAGCTTTTCTTATCTTTGTTT. Deletion right flank: AGTTAACAAACATGAAACACGACCGAATTT.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036563 Copy
http://www.wormbase.org/db/get?name=WBStrain00036660
Source Database: WormBase (WB)
Affected Genes: WBGene00003720(nhr-130)
Genomic Alteration: WBGene00003720(nhr-130)
Availability: available
Source References: EMPTY
Synonyms: nhr-130(gk710) V.
Alternate IDs: WB-STRAIN:VC1520, CGC_VC1520
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"T01G6.8. External left primer: TTCGGATACTTTTCGGTTGC. External right primer: TTCCATTTTTACGGTCCTCG. Internal left primer: GATATGAGGTCCCGATCGAA. Internal right primer: TGAGGCAGATTGGTGTTCTG. Internal WT amplicon: 2444 bp. Deletion size: 1218 bp. Deletion left flank: TTTGAAGCTTCCGCAAAAATTTACATTCCC. Deletion right flank: AAAAAAAATACCGGAAAATAGGCTCCGCCC. Insertion Sequence: AAA."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036660 Copy
http://www.wormbase.org/db/get?name=WBStrain00036665
Source Database: WormBase (WB)
Affected Genes: WBGene00003658(nhr-68)
Genomic Alteration: WBGene00003658(nhr-68)
Availability: available
Source References: PMID:33016879, PMID:37043428
Synonyms: nhr-68(gk708) V.
Alternate IDs: WB-STRAIN:VC1527, CGC_VC1527
Notes: H12C20.3. External left primer: CGGTTCTAATCCTCCGTCAA. External right primer: AGCGCACCTGTAAATTGCTT. Internal left primer: TGCCTTGTTTGCCAAGATTT. Internal right primer: CTCCAACCCGTCCTTCTGTA. Internal WT amplicon: 1761 bp. Deletion size: 1301 bp. Deletion left flank: TTATATCATGTTTAGCCCACAAATATTCTA. Deletion right flank: TTTCCGGATGGAACATATTATGATAGAACT.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain mapped, WBPaper00060431 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00036665 Copy
http://www.wormbase.org/db/get?name=WBStrain00036667
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00003183(mei-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00003183(mei-1)
Availability: available
Source References: PMID:37603562
Synonyms: mei-1(ok2000) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC1530, CGC_VC1530
Notes: Supplementary_genotype mei-1 (ok2000) I / hT2[bli-4(e937) let-7(q782) qIs48 (I;III)|"T01G9.5. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2000 homozygotes (sterile, lays eggs that don't hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TAATTGTTTGTCGCGGATGA. External right primer: GATGAAGGTGGCCTTGAAAA. Internal left primer: TGTTTCCAACAAGTGAGCCA. Internal right primer: CAAAAACCAAAGCTAGGCCA. Internal WT amplicon: 2180 bp. Deletion size: 1378 bp. Deletion left flank: ACAAAGAAAGGAGTTGGAGCAGCAGGTCCA. Deletion right flank: CAAAGAATGGTGTGACTCTTTTGGTGCCAT. Insertion Sequence: TGTAAATCAACTATTTATTGTGATCTCCTTTTAGTTTAAAATATTGTGGCCTAGCTTTG GGTTTTTGAAA."|"T01G9.5. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2000 homozygotes (sterile, lays eggs that don't hatch). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TAATTGTTTGTCGCGGATGA. External right primer: GATGAAGGTGGCCTTGAAAA. Internal left primer: TGTTTCCAACAAGTGAGCCA. Internal right primer: CAAAAACCAAAGCTAGGCCA. Internal WT amplicon: 2180 bp. Deletion size: 1378 bp. Deletion left flank: ACAAAGAAAGGAGTTGGAGCAGCAGGTCCA. Deletion right flank: CAAAGAATGGTGTGACTCTTTTGGTGCCAT. Insertion Sequence: TGTAAATCAACTATTTATTGTGATCTCCTTTTAGTTTAAAATATTGTGGCCTAGCTTTGGGTTTTTGAAA."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036667 Copy
http://www.wormbase.org/db/get?name=WBStrain00036640
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00001503(fum-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001503(fum-1)
Availability: available
Source References: EMPTY
Synonyms: fum-1(ok1998) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC1497, CGC_VC1497
Notes: H14A12.2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+ (heterozygotes), arrested hT2 aneuploids, and non-GFP ok1998 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP+ and check for correct segregation of progeny to maintain. External left primer: ACTTGTGCGGGAGAAGAGAA. External right primer: CGAATTAAGCTTTCAAGGCG. Internal left primer: GAACCATGCCGAGTTTGATT. Internal right primer: TGAACATTTGGGGACATTGA. Internal WT amplicon: 2152 bp. Deletion size: 1351 bp. Deletion left flank: ACTTTCGGAGAGCTCGAGGTTCCAGCCGAC. Deletion right flank: TGCTCACAAGAACGGCACCACCCTTGTCCA.|"H14A12.2. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1998 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACTTGTGCGGGAGAAGAGAA. External right primer: CGAATTAAGCTTTCAAGGCG. Internal left primer: GAACCATGCCGAGTTTGATT. Internal right primer: TGAACATTTGGGGACATTGA. Internal WT amplicon: 2152 bp. Deletion size: 1351 bp. Deletion left flank: ACTTTCGGAGAGCTCGAGGTTCCAGCCGAC. Deletion right flank: TGCTCACAAGAACGGCACCACCCTTGTCCA."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036640 Copy
http://www.wormbase.org/db/get?name=WBStrain00036615
Source Database: WormBase (WB)
Affected Genes: WBGene00003144(max-2)
Genomic Alteration: WBGene00003144(max-2)
Availability: available
Source References: PMID:37603562
Synonyms: max-2(ok1904) II.
Alternate IDs: WB-STRAIN:VC1462, CGC_VC1462
Notes: Supplementary_genotype max-2 (ok1904)II|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y38F1A.10. Superficially wild type. External left primer: GGCACCGTTGTTTTAGATGC. External right primer: GAATGCAGATTTTTGCACGA. Internal left primer: CCCGTTTTGAGCAATCAAGT. Internal right primer: CTCTGCGTGTCAAAAATCCA. Internal WT amplicon: 3024 bp. Deletion size: 2220 bp. Deletion left flank: TTGAAAGTGTGGTGGGTGGGCGGAGATTCC. Deletion right flank: AAAGCTTTTCACGATGAGATGCTCGAACAC."
Proper citation: RRID:WB-STRAIN:WBStrain00036615 Copy
http://www.wormbase.org/db/get?name=WBStrain00036616
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00001651(gon-2)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001651(gon-2)
Availability: available
Source References: PMID:37541249
Synonyms: gon-2(ok465) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC1463, CGC_VC1463
Notes: Mutagen:UV/TMP|"Supplementary_genotype gon-2(ok465) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III)"|"T01H8.5. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok465 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGAGAGGTTAAATCAGCCCG. External right primer: GTTGCTGCATTTGGACTTGA. Internal left primer: TGGTGAATAATTGGCTGCAA. Internal right primer: GATGCTTTGGGTTTGTGCTT. Internal WT amplicon: 2829 bp. Deletion size: 507 bp. Deletion left flank: TAATGGTAATCTGACAGAAAACGATTTTTT. Deletion right flank: AGAACTAGAGATATTTTTTGATAAAAACGC."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036616 Copy
http://www.wormbase.org/db/get?name=WBStrain00036618
Source Database: WormBase (WB)
Affected Genes: WBGene00006963(xpa-1)|WBGene00010642(mks-6)
Genomic Alteration: WBGene00006963(xpa-1), WBGene00010642(mks-6)
Availability: available
Source References: EMPTY
Synonyms: xpa-1&K07G5.3(gk674) I.
Alternate IDs: WB-STRAIN:VC1466, CGC_VC1466
Notes: K07G5.2, K07G5.3. External left primer: AATTTTCAGGCGAAGAAGCA. External right primer: TTCCACGTGTTCTTTCCACA. Internal left primer: GGTTTGATGGACAGTTGGCT. Internal right primer: ACCTTCAGACGTTTGCGACT. Internal WT amplicon: 1659 bp. Deletion size: 560 bp. Deletion left flank: CGTGGAAGAGGACACATGGAGAAGAACATG. Deletion right flank: AAGAACATTTGATGAAATTTAAAGCAAAAG.|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036618 Copy
http://www.wormbase.org/db/get?name=WBStrain00036775
Source Database: WormBase (WB)
Affected Genes: WBGene00003095(lys-6)
Genomic Alteration: WBGene00003095(lys-6)
Availability: available
Source References: EMPTY
Synonyms: lys-6(ok2075) IV.
Alternate IDs: WB-STRAIN:VC1662, CGC_VC1662
Notes: F58B3.3. External left primer: TTGTTTGATTGCACGTGGTT. External right primer: GATCGTGGTGTGGTTCACAG. Internal left primer: TTGGCTTCCAAACCATTTTC. Internal right primer: ATCAATGCCTCTGGATCGAC. Internal WT amplicon: 2135 bp. Deletion size: 1265 bp. Deletion left flank: GAGAACGCTTTCGTGAATCGGGATTTAAAA. Deletion right flank: TTTAGGCAAGGGAAGATGTATCCATCGACA. Insertion Sequence: GGCAAGGGAAGAAGAGA.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00036775 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
