Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
PS7190 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031007 | Caenorhabditis elegans | syIs409 X. | Made_by: Han Wang and Jonathan Liu|"syIs409"|"syIs409 [15xUAS::pes-10::mCherry::H2B::let-858 3'UTR + unc-122p::GFP + pBlueScript]. mCherry::H2B cGAL effector. Very weak background fluorescence in first ring of intestinal cells and posterior intestinal cells. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148." | WB-STRAIN:WBStrain00031007 | WormBase (WB) | WB | available | WB-STRAIN:PS7190, CGC_PS7190 | 2026-08-08 10:14:04 | 0 | |||||
|
PS7185 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031005 | Caenorhabditis elegans | syIs406 IV. | Made_by: Han Wang and Jonathan Liu|"syIs406 [15xUAS::pes-10::GFP::H2B::let-858 3'UTR + ttx-3p::RFP + pBlueScript]. GFP::H2B effector. Very weak background fluorescence in first ring of intestinal cells and posterior intestinal cells. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148." | WB-STRAIN:WBStrain00031005 | WormBase (WB) | WB | available | WB-STRAIN:PS7185, CGC_PS7185 | 2026-08-08 10:14:02 | 0 | |||||
|
PS7731 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031014 | Caenorhabditis elegans | K03E5.2(sy1082) I. | Made_by: Heenam Park|"STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc"|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of K03E5.2.Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).left flanking sequence: tatattttttgaaattttccagggaATGACCGGTT; right flanking sequence: GTCAAGGGAAAGCATTTGAAGAGAATTTGGGAGCT;inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc sgRNA: ATTGCTTGGCACCTCGACGGReference: Wang H, et al. G3 (Bethesda)." | WBGene00019361(clik-3) | WBGene00019361(clik-3) | WB-STRAIN:WBStrain00031014 | WormBase (WB) | WB | available | PMID:30224336 | WB-STRAIN:PS7731, CGC_PS7731 | 2026-08-08 10:14:02 | 0 | ||
|
PS7778 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031018 | Caenorhabditis elegans | clik-1(sy1084) V. | Made_by: Heenam Park|"STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc"|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clik-1(T25F10.6) Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).left flanking sequence: GGAGGAGATCGAGGAGGACGAGCCAGTCGCCGACG; right flanking sequence: AGAACCAAGAGCCAGAGgtaatcgttttttgccat;inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagcReference: Wang H, et al. G3 (Bethesda)." | WBGene00020808(clik-1) | WBGene00020808(clik-1) | WB-STRAIN:WBStrain00031018 | WormBase (WB) | WB | available | PMID:30224336 | WB-STRAIN:PS7778, CGC_PS7778 | 2026-08-08 10:14:02 | 0 | ||
|
PS7734 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031016 | Caenorhabditis elegans | T05C3.2(sy1080) V. | Made_by: Han Wang/Heenam Park/Wen Chen|"STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc"|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of T05C3.2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: GTTCACCGATACAACTGTAGAACGAAACGCGCTAARight flanking sequence: TGGAGGAGATTTATCCAAAGCTTAAGGAATACTGCinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AGAACGAAACGCGCTAATGGMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616" | WBGene00020254(T05C3.2) | WBGene00020254(T05C3.2) | WB-STRAIN:WBStrain00031016 | WormBase (WB) | WB | available | PMID:30224336 | WB-STRAIN:PS7734, CGC_PS7734 | 2026-08-08 10:14:04 | 0 | ||
|
PT830 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031068 | Caenorhabditis elegans | nphp-1(ok500) II; nphp-4(tm925) him-5(e1490) V. | Made_by: A. Jauregui|"Male mating response defect." | WBGene00001864(him-5)|WBGene00010898(nphp-1)|WBGene00011261(nphp-4) | WBGene00001864(him-5), WBGene00010898(nphp-1), WBGene00011261(nphp-4) | WB-STRAIN:WBStrain00031068 | WormBase (WB) | WB | available | PMID:38302462 | WB-STRAIN:PT830, CGC_PT830 | 2026-08-08 10:14:03 | 0 | ||
|
PT709 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031067 | Caenorhabditis elegans | nphp-4(tm925) him-5(e1490) V. | Made_by: A. Jauregui|"Superficially WT." | WBGene00001864(him-5)|WBGene00011261(nphp-4) | WBGene00001864(him-5), WBGene00011261(nphp-4) | WB-STRAIN:WBStrain00031067 | WormBase (WB) | WB | available | WB-STRAIN:PT709, CGC_PT709 | 2026-08-08 10:14:05 | 1 | |||
|
PT559 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031066 | Caenorhabditis elegans | nphp-1(ok500) II; him-5(e1490) V. | Made_by: A. Jauregui|"Superficially WT." | WBGene00001864(him-5)|WBGene00010898(nphp-1) | WBGene00001864(him-5), WBGene00010898(nphp-1) | WB-STRAIN:WBStrain00031066 | WormBase (WB) | WB | available | WB-STRAIN:PT559, CGC_PT559 | 2026-08-08 10:14:03 | 0 | |||
|
PT505 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031065 | Caenorhabditis elegans | flp-20(pk1596) X. | EMPTY | WBGene00001463(flp-20) | WBGene00001463(flp-20) | WB-STRAIN:WBStrain00031065 | WormBase (WB) | WB | available | PMID:39024405 | WB-STRAIN:PT505, CGC_PT505 | 2026-08-08 10:14:03 | 2 | ||
|
PT501 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031064 | Caenorhabditis elegans | flp-8(pk360) X. | Reference: Liu T, et al. J Neurosci. 2007 Jul 4;27(27):7174-82. | WBGene00001451(flp-8) | WBGene00001451(flp-8) | WB-STRAIN:WBStrain00031064 | WormBase (WB) | WB | available | PMID:39024405 | WB-STRAIN:PT501, CGC_PT501 | 2026-08-08 10:14:05 | 2 | ||
|
PT442 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031063 | Caenorhabditis elegans | klp-6(sy511) III; him-5(e1490) V. | Males Lov and response defective. Mislocalizes pkd-2::GFP in cilia. sy511 contains a nonsense mutation in exon 10 (C-T transition = Q706stop). | WBGene00001864(him-5)|WBGene00002218(klp-6) | WBGene00001864(him-5), WBGene00002218(klp-6) | WB-STRAIN:WBStrain00031063 | WormBase (WB) | WB | available | WB-STRAIN:PT442, CGC_PT442 | 2026-08-08 10:14:03 | 1 | |||
|
PT2193 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031071 | Caenorhabditis elegans | eat-4(n2474) III; him-5(e1490) V. | Defective in male sex drive regulation. Reference: Nat Neurosci. 2012 Dec;15(12):1675-82. | WBGene00001135(eat-4)|WBGene00001864(him-5) | WBGene00001135(eat-4), WBGene00001864(him-5) | WB-STRAIN:WBStrain00031071 | WormBase (WB) | WB | available | WB-STRAIN:PT2193, CGC_PT2193 | 2026-08-08 10:14:03 | 0 | |||
|
PT1443 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031070 | Caenorhabditis elegans | inpp-5K(my15) III; him-5(e1490) V. | Spermatogenesis abnormal with small brood size. PKD-2::GFP ciliary localization defective. Maintain at 20 C. inpp-5K formerly known as cil-1. Reference: Bae Y, et al. 2009 Curr Bio 19(19):1599-607. | WBGene00001864(him-5)|WBGene00086546(inpp-5K) | WBGene00001864(him-5), WBGene00086546(inpp-5K) | WB-STRAIN:WBStrain00031070 | WormBase (WB) | WB | available | WB-STRAIN:PT1443, CGC_PT1443 | 2026-08-08 10:14:05 | 1 | |||
|
PT2351 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031073 | Caenorhabditis elegans | him-5(e1490) V; myEx741. | myEx741 [pdfr-1p(3kb)::NLS::RFP + unc-122::GFP]. Him. Pick RFP+ and GFP+ to maintain. Reference: Barrios A, et al. Nat Neurosci. 2012 Dec;15(12):1675-82. | WBGene00001864(him-5) | WBGene00001864(him-5) | WB-STRAIN:WBStrain00031073 | WormBase (WB) | WB | available | WB-STRAIN:PT2351, CGC_PT2351 | 2026-08-08 10:14:05 | 0 | |||
|
PS8027 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031058 | Caenorhabditis elegans | nlp-67(sy1176) X. | Made_by: Heenam Park|"STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc"|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-67; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: CTCACTTTCTTGCTCGTCACTCTTTTTGCCCTCGCRight flanking sequence: CAATGTCATGCAAGCACAGCGTTACGATCGAGCCinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GTGCTTGCATGACATTGGCGMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616" | WBGene00011227(nlp-67) | WBGene00011227(nlp-67) | WB-STRAIN:WBStrain00031058 | WormBase (WB) | WB | available | PMID:30224336 | WB-STRAIN:PS8027, CGC_PS8027 | 2026-08-08 10:14:05 | 1 | ||
|
PS8008 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031052 | Caenorhabditis elegans | ZC376.2(sy1170) V. | Made_by: Heenam Park|"STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc"|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of ZC376.2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCCTGGGACGGAGTTTTGGAGGCGAAGGAGTATA Right flanking sequence: AAGCGGCTTGTATGAGTGATCAGAAgtaagagata inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGAGGCGAAGGAGTATAAAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616" | WBGene00013874(cest-2.2) | WBGene00013874(cest-2.2) | WB-STRAIN:WBStrain00031052 | WormBase (WB) | WB | available | PMID:30224336 | WB-STRAIN:PS8008, CGC_PS8008 | 2026-08-08 10:14:05 | 0 | ||
|
PS7837 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031024 | Caenorhabditis elegans | aex-2(sy1078) X. | Made_by: Heenam Park|"STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc"|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of aex-2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: CGGAAACGGCTTTTATGGATTACTGCAGCGACATGRight flanking sequence: GGGAGGACTTTATGCAATGAACATCGCACTTGTCAinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATTACTGCAGCGACATGGGGMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616" | WBGene00000085(aex-2) | WBGene00000085(aex-2) | WB-STRAIN:WBStrain00031024 | WormBase (WB) | WB | available | PMID:30224336 PMID:38590801 |
WB-STRAIN:PS7837, CGC_PS7837 | 2026-08-08 10:14:02 | 0 | ||
|
PY1157 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031124 | Caenorhabditis elegans | oyls17. | Made_by: Piali Sengupta's lab|"oyls17 [gcy-8p::GFP + lin-15(+)]. AFD neurons are marked with GFP. Used by CeNGEN project for RNA-Seq (https:" | WBGene00001535(gcy-8) | WBGene00001535(gcy-8) | WB-STRAIN:WBStrain00031124 | WormBase (WB) | WB | available | WB-STRAIN:PY1157, CGC_PY1157 | 2026-08-08 10:14:06 | 0 | |||
|
PY1133 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031123 | Caenorhabditis elegans | unc-130(oy10) II. | Made_by: T. Sarafi-Reinach|"Slighty Dpy. Slighty Unc. Ventral clear patch due to distal tip cell migration defects. Ectopic expression of AWA neuronal markers." | WBGene00006070(str-2)|WBGene00006853(unc-130) | WBGene00006070(str-2), WBGene00006853(unc-130) | WB-STRAIN:WBStrain00031123 | WormBase (WB) | WB | available | WB-STRAIN:PY1133, CGC_PY1133 | 2026-08-08 10:14:04 | 0 | |||
|
PY1322 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031127 | Caenorhabditis elegans | oyIs18 [gcy-8p::gfp] | oyIs18 [gcy-8::GFP]. GFP in AFD. | WBGene00001535(gcy-8) | WBGene00001535(gcy-8) | WB-STRAIN:WBStrain00031127 | WormBase (WB) | WB | available | PMID:38530893 | WB-STRAIN:PY1322, CGC_PY1322 | 2026-08-08 10:14:06 | 1 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
