Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
RB1365 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032064 | Caenorhabditis elegans | npr-16(ok1541) X. | F56B6.5 Homozygous. Outer Left Sequence: acaaatcgcaattttccagc. Outer Right Sequence: acaagtccgcaaggtcacat. Inner Left Sequence: caagggtcttcacaatcggt. Inner Right Sequence: tttgatttctcatcgggagg. Inner Primer PCR Length: 3344. Estimated Deletion Size: about 1450 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00006864(npr-16) | WBGene00006864(npr-16) | WB-STRAIN:WBStrain00032064 | WormBase (WB) | WB | available | PMID:38302462 PMID:38446031 |
WB-STRAIN:RB1365, CGC_RB1365 | 2026-08-15 09:31:49 | 4 | ||
|
RB1332 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032031 | Caenorhabditis elegans | trx-1(ok1449) II. | B0228.5 Homozygous. Outer Left Sequence: cgccgtggttaacctcttta. Outer Right Sequence: ttatcggacaataggcggac. Inner Left Sequence: ctgttgactcccaacaccct. Inner Right Sequence: ttgcaaaagaaattttcgcc. Inner Primer PCR Length: 2357. Estimated Deletion Size: about 850 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00015062(trx-1) | WBGene00015062(trx-1) | WB-STRAIN:WBStrain00032031 | WormBase (WB) | WB | available | PMID:38446031 | WB-STRAIN:RB1332, CGC_RB1332 | 2026-08-15 09:31:48 | 2 | ||
|
RB1340 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032039 | Caenorhabditis elegans | nlp-1(ok1469) X. | C01C4.1 Homozygous. Outer Left Sequence: gaaacattgtgctccaccct. Outer Right Sequence: attcagaagcggaaagagca. Inner Left Sequence: gtgcgtacccagagcatttt. Inner Right Sequence: caattgtgtcctccccctaa. Inner Primer PCR Length: 2212. Estimated Deletion Size: about 700 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00003739(nlp-1) | WBGene00003739(nlp-1) | WB-STRAIN:WBStrain00032039 | WormBase (WB) | WB | available | WB-STRAIN:RB1340, CGC_RB1340 | 2026-08-15 09:31:48 | 1 | |||
|
RB1341 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032040 | Caenorhabditis elegans | nlp-1(ok1470) X. | C01C4.1 Homozygous. Outer Left Sequence: gaaacattgtgctccaccct. Outer Right Sequence: attcagaagcggaaagagca. Inner Left Sequence: gtgcgtacccagagcatttt. Inner Right Sequence: caattgtgtcctccccctaa. Inner Primer PCR Length: 2212. Estimated Deletion Size: about 600 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain mapped, WBPaper00059878 added based on AFP_Strain data." | WBGene00003739(nlp-1) | WBGene00003739(nlp-1) | WB-STRAIN:WBStrain00032040 | WormBase (WB) | WB | available | PMID:32576621 PMID:38573858 |
WB-STRAIN:RB1341, CGC_RB1341 | 2026-08-15 09:31:48 | 1 | ||
|
RB1342 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032041 | Caenorhabditis elegans | ogt-1h | K04G7.3 Homozygous. Outer Left Sequence: gccaaagaattgatttcgga. Outer Right Sequence: tgctcttgcaccacaaccta. Inner Left Sequence: acctgtccgagaccattctg. Inner Right Sequence: ccaacgctattgctcctctc. Inner Primer PCR Length: 2730. Estimated Deletion Size: about 1300 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain mapped, WBPaper00059970 added based on AFP_Strain data." | WBGene00003858(ogt-1) | WBGene00003858(ogt-1) | WB-STRAIN:WBStrain00032041 | WormBase (WB) | WB | available | PMID:32628333 PMID:37991448 PMID:38488606 |
WB-STRAIN:RB1342, CGC_RB1342 | 2026-08-15 09:31:48 | 2 | ||
|
RB1401 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032099 | Caenorhabditis elegans | T19B10.6(ok260) V. | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"T19B10.6. Unc."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00011834(dvc-1) | WBGene00011834(dvc-1) | WB-STRAIN:WBStrain00032099 | WormBase (WB) | WB | available | PMID:31839537 | WB-STRAIN:RB1401, CGC_RB1401 | 2026-08-15 09:31:49 | 1 | ||
|
RB1311 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032010 | Caenorhabditis elegans | R05D11.8(ok1427) I. | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"R05D11.8 Homozygous. Outer Left Sequence: gctgcgtgaacatcaagaaa. Outer Right Sequence: attccaacgacttgccaaag. Inner Left Sequence: tttgaccatggcgaatgtta. Inner Right Sequence: tagagggatcgctggagaaa. Inner Primer PCR Length: 2546. Estimated Deletion Size: about 800 bp."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00011036(edc-3) | WBGene00011036(edc-3) | WB-STRAIN:WBStrain00032010 | WormBase (WB) | WB | available | WB-STRAIN:RB1311, CGC_RB1311 | 2026-08-15 09:31:48 | 1 | |||
|
RB1325 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032024 | Caenorhabditis elegans | C53C7.1(ok1442) X. | C53C7.1 Homozygous. Outer Left Sequence: ggatcgtcttgtggtgcttt. Outer Right Sequence: ggggcctcttaacctttttg. Inner Left Sequence: ctggattgccctgaaattgt. Inner Right Sequence: gcagacaaagcatgacctga. Inner Primer PCR Length: 3020. 11/18/04: From Neline Kriek: This has a 788 bp deletion with a 13 bp insertion (TTCTTTTTTTTGA). The sequence across the breakpoint is: actacgacgtggtgtctttTTCTTTTTTTTGAtgacgtgagtttt.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00008278(npr-10) | WBGene00008278(npr-10) | WB-STRAIN:WBStrain00032024 | WormBase (WB) | WB | available | PMID:38446031 | WB-STRAIN:RB1325, CGC_RB1325 | 2026-08-15 09:31:48 | 2 | ||
|
RB1321 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032020 | Caenorhabditis elegans | C56G3.1(ok1439) X. | C56G3.1 Homozygous. Outer Left Sequence: atagaaaggcaaccgggatt. Outer Right Sequence: cggtaagaaagcggaaatga. Inner Left Sequence: gtttgctctttttggtggga. Inner Right Sequence: catcgtccaatacaatgcga. Inner Primer PCR Length: 2408. Deletion Size: 838 bp deletion with a 1 bp insertion. Sequence across breakpoint from Neline Kriek: tggattggtgataatggctgtagtattgattattaataaccatattccaggaa.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00016984(npr-8) | WBGene00016984(npr-8) | WB-STRAIN:WBStrain00032020 | WormBase (WB) | WB | available | WB-STRAIN:RB1321, CGC_RB1321 | 2026-08-15 09:31:48 | 1 | |||
|
RB1377 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032076 | Caenorhabditis elegans | acs-17(ok1562) X. | C46F4.2 Homozygous. Outer Left Sequence: ggtcgattcttcgatttcca. Outer Right Sequence: tggggagcataggtttttca. Inner Left Sequence: cctaaaacatatggccaccg. Inner Right Sequence: tgaacgcacggtatgtttgt. Inner Primer PCR Length: 3216. Estimated Deletion Size: about 1700 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00016716(acs-17) | WBGene00016716(acs-17) | WB-STRAIN:WBStrain00032076 | WormBase (WB) | WB | available | WB-STRAIN:RB1377, CGC_RB1377 | 2026-08-15 09:31:49 | 1 | |||
|
RB1388 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032086 | Caenorhabditis elegans | ZK1251.1&ins-7(ok1573) IV. | Made_by: Oklahoma KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK1251.1, ZK1251.2. Superficially wild type." | WBGene00002090(ins-7)|WBGene00014240(htas-1) | WBGene00002090(ins-7), WBGene00014240(htas-1) | WB-STRAIN:WBStrain00032086 | WormBase (WB) | WB | available | WB-STRAIN:RB1388, CGC_RB1388 | 2026-08-15 09:31:49 | 2 | |||
|
RB1480 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032177 | Caenorhabditis elegans | T05F1.1(ok1731) I. | Made_by: OMRF Knockout Group|"T05F1.1 Homozygous. Outer Left Sequence: cttcaagagtggccatttcc. Outer Right Sequence: cttcaagagtggccatttcc. Inner Left Sequence: tttaatgcgggaaagtgacc. Inner Right Sequence: catgcgtgtgcctttaactg. Inner Primer PCR Length: 2592. Estimated Deletion Size: about 1100 bp."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00011488(nra-2) | WBGene00011488(nra-2) | WB-STRAIN:WBStrain00032177 | WormBase (WB) | WB | available | WB-STRAIN:RB1480, CGC_RB1480 | 2026-08-15 09:31:51 | 1 | |||
|
RB1485 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032182 | Caenorhabditis elegans | csp-2(ok1742) IV. | Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y73B6BL.7. Homozygous. Outer Left Sequence: GCGACGAAGAATGTTCAGGT. Outer Right Sequence: TTATGTCTTGGTGCGTCTCG. Inner Left Sequence: AGATTGATCGGCTTTGCACT. Inner Right Sequence: AGATGCCGACGTCAATTTTC. Inner Primer PCR Length: 3112 bp. Deletion Size: 1722 bp. Deletion left flank: TTTCCAAATTCATAGGAAAAATACTCTGAA. Deletion right flank: TTGCAAATTCTTGAAAGTAAAGTCAACTTC." | WBGene00000820(csp-2) | WBGene00000820(csp-2) | WB-STRAIN:WBStrain00032182 | WormBase (WB) | WB | available | WB-STRAIN:RB1485, CGC_RB1485 | 2026-08-15 09:31:51 | 1 | |||
|
RB1483 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032180 | Caenorhabditis elegans | ifa-4(ok1734) X. | K05B2.3 Homozygous. Outer Left Sequence: atgtttcactttggcggttc. Outer Right Sequence: agagcgaataccgaagctca. Inner Left Sequence: cgagagtaattccgggttca. Inner Right Sequence: tcgcaagatggagaaggact. Inner Primer PCR Length: 2608. Estimated Deletion Size: about 600 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00002052(ifa-4) | WBGene00002052(ifa-4) | WB-STRAIN:WBStrain00032180 | WormBase (WB) | WB | available | WB-STRAIN:RB1483, CGC_RB1483 | 2026-08-15 09:31:51 | 1 | |||
|
RB1405 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032103 | Caenorhabditis elegans | Y59H11AL.1(ok1598) IV. | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y59H11AL.1 Homozygous. Outer Left Sequence: tggaacacttccccaaactc. Outer Right Sequence: tgatacgggaaaagctacgc. Inner Left Sequence: ggaagcagtttgctctccag. Inner Right Sequence: aattggcagagttgtttcgg. Inner Primer PCR Length: 3299. Estimated Deletion Size: about 2500 bp." | WBGene00022004(npr-22) | WBGene00022004(npr-22) | WB-STRAIN:WBStrain00032103 | WormBase (WB) | WB | available | PMID:37310929 PMID:38446031 |
WB-STRAIN:RB1405, CGC_RB1405 | 2026-08-15 09:31:49 | 2 | ||
|
RB1487 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032184 | Caenorhabditis elegans | asm-3(ok1744) IV. | Made_by: OMRF Knockout Group|"Reference WBPaper00059117 added based on published strain data identified by Textpresso literature search."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"W03G1.7 Homozygous. Outer Left Sequence: aagccagaattccgtgtttg. Outer Right Sequence: tcgtcctttctctcgcattt. Inner Left Sequence: cttgcactcctcctttccac. Inner Right Sequence: ggtgacagaatgcgaggaat. Inner Primer PCR Length: 3344. Estimated Deletion Size: about 1400 bp." | WBGene00000213(asm-3) | WBGene00000213(asm-3) | WB-STRAIN:WBStrain00032184 | WormBase (WB) | WB | available | PMID:31940482 | WB-STRAIN:RB1487, CGC_RB1487 | 2026-08-15 09:31:51 | 2 | ||
|
RB1465 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032163 | Caenorhabditis elegans | C23H3.4(ok1693) II. | C23H3.4. Homozygous. Outer Left Sequence: CCAAATTCCCCACTTACCCT. Outer Right Sequence: CTGAAATTTTGCCACGGATT. Inner Left Sequence: AGCCCAAGCCAATTATCCTT. Inner Right Sequence: AACACGAACTTTGAATCGCC. Inner Primer PCR Length: 3320 bp. Deletion Size: 963 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00016020(sptl-1) | WBGene00016020(sptl-1) | WB-STRAIN:WBStrain00032163 | WormBase (WB) | WB | available | PMID:25437839 | WB-STRAIN:RB1465, CGC_RB1465 | 2026-08-15 09:31:50 | 1 | ||
|
RB1473 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032170 | Caenorhabditis elegans | tli-1(ok1724) I. | F25H2.1 Homozygous. Outer Left Sequence: tccagcaagaccttcgaaac. Outer Right Sequence: tgctgaacgtcgtagacagg. Inner Left Sequence: gagccaacaccaagcagaat. Inner Right Sequence: ttacaggtgctcgttggaga. Inner Primer PCR Length: 2848. Estimated Deletion Size: about 600 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00006578(tli-1) | WBGene00006578(tli-1) | WB-STRAIN:WBStrain00032170 | WormBase (WB) | WB | available | WB-STRAIN:RB1473, CGC_RB1473 | 2026-08-15 09:31:51 | 1 | |||
|
RB1436 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032134 | Caenorhabditis elegans | sulp-1(ok1639) I. | C55B7.6. Homozygous. Outer Left Sequence: CACGTGGTACTGGCAGAAAA. Outer Right Sequence: CGGGTACACCAGCCAATAGT. Inner Left Sequence: AAACACGGAACTTGCCAAAC. Inner Right Sequence: CAAATGTCCGTTCACACCTG. Inner Primer PCR Length: 2950 bp. Deletion Size: 1004 bp. Deletion left flank: ATTTTTTATTCCTCTACATGGGATGCGGTT. Deletion right flank: ACCCTTCTTCAGCAAAAATAATATTTTTTT. Insertion Sequence: CCTCTACATGGGAT.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00016945(sulp-1) | WBGene00016945(sulp-1) | WB-STRAIN:WBStrain00032134 | WormBase (WB) | WB | available | WB-STRAIN:RB1436, CGC_RB1436 | 2026-08-15 09:31:50 | 1 | |||
|
RB1498 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032195 | Caenorhabditis elegans | hyl-2(ok1766) X. | K02G10.6 Homozygous. Outer Left Sequence: acgcagtttccaagcatttc. Outer Right Sequence: tccttttcctcctcggtttt. Inner Left Sequence: gggggagtgatggaagaaat. Inner Right Sequence: ttgcaaaccaattgcaagaa. Inner Primer PCR Length: 3075. Estimated Deletion Size: about 1600 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00002044(hyl-2) | WBGene00002044(hyl-2) | WB-STRAIN:WBStrain00032195 | WormBase (WB) | WB | available | WB-STRAIN:RB1498, CGC_RB1498 | 2026-08-15 09:31:51 | 1 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
