Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00040135
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; wwIs20; wwEx40.
Alternate IDs: WB-STRAIN:VL551, CGC_VL551
Notes: wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. wwEx40 [cnd-1::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
Proper citation: RRID:WB-STRAIN:WBStrain00040135 Copy
http://www.wormbase.org/db/get?name=WBStrain00040134
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; wwIs20; leEx1566.
Alternate IDs: WB-STRAIN:VL536, CGC_VL536
Notes: wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. leEx1566 [lin-32::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
Proper citation: RRID:WB-STRAIN:WBStrain00040134 Copy
http://www.wormbase.org/db/get?name=WBStrain00040144
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; wwIs20; leEx1556.
Alternate IDs: WB-STRAIN:VL585, CGC_VL585
Notes: wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. leEx1556 [hlh-12::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
Proper citation: RRID:WB-STRAIN:WBStrain00040144 Copy
http://www.wormbase.org/db/get?name=WBStrain00040143
Source Database: WormBase (WB)
Affected Genes: WBGene00003676(nhr-86)
Genomic Alteration: WBGene00003676(nhr-86)
Availability: available
Source References: EMPTY
Synonyms: nhr-86(tm2590) V; wwIs22.
Alternate IDs: WB-STRAIN:VL584, CGC_VL584
Notes: wwIs22 [nhr-86p::nhr-86(ORF)::GFP + unc-119(+)]. Him. Reference: Arda HE, et al. (2010) Mol Syst Biol 6:367.
Proper citation: RRID:WB-STRAIN:WBStrain00040143 Copy
http://www.wormbase.org/db/get?name=WBStrain00040140
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; wwIs20; leEx1546.
Alternate IDs: WB-STRAIN:VL566, CGC_VL566
Notes: wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. leEx1546 [hlh-2::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
Proper citation: RRID:WB-STRAIN:WBStrain00040140 Copy
http://www.wormbase.org/db/get?name=WBStrain00040149
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; wwIs12.
Alternate IDs: WB-STRAIN:VL657, CGC_VL657
Notes: Made_by: N Martinez/M Ow|"wwIs12 [mir-52p::GFP + unc-119(+)]. Wild type."
Proper citation: RRID:WB-STRAIN:WBStrain00040149 Copy
http://www.wormbase.org/db/get?name=WBStrain00040145
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; wwIs20; wwEx42.
Alternate IDs: WB-STRAIN:VL586, CGC_VL586
Notes: wwIs20 [hlh-2::mCherry::his-11 + unc-119(+)]. wwEx42 [hlh-15::GFP + unc-119(+)]. Superficially wildtype. Grove C. A., De Masi F., et al (2009) Cell 138(2); 314-327.
Proper citation: RRID:WB-STRAIN:WBStrain00040145 Copy
http://www.wormbase.org/db/get?name=WBStrain00040147
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; wwIs16.
Alternate IDs: WB-STRAIN:VL621, CGC_VL621
Notes: Made_by: N Martinez/M Ow|"wwIs16 [mir-75p::GFP + unc-119(+)]. Wild type."
Proper citation: RRID:WB-STRAIN:WBStrain00040147 Copy
http://www.wormbase.org/db/get?name=WBStrain00040230
Source Database: WormBase (WB)
Affected Genes: WBGene00003031(lin-46)|WBGene00003312(mir-84)
Genomic Alteration: WBGene00003031(lin-46), WBGene00003312(mir-84)
Availability: available
Source References: EMPTY
Synonyms: lin-46(ma164) nDf51 V; mir-84(n4037) X.
Alternate IDs: WB-STRAIN:VT1145, CGC_VT1145
Notes: Strong retarded heterochronic phenotype, reiteration of L2-stage program resulting in extra seam cells and failure to generate alae. Vul. nDf51 deletion deletes 5930 bp of cosmid F56A12 from 3520 to 9451, starting 1762 bp upstream of mir-241, covering mir-241 and lin-58. lin-58 is at 5908-5885 and mir-241 is at 7681-7661. nDf51: 5' of deletion: TGAAAGAAGCAGTTGAAAGCTTGCAGCCGACGAAAACTAGTGTAGCG. 3' of deletion: CTCACAATATTTTCATTTGAATATCGCGTTGAATTTGTAAGTGT. n4037 deletion is between 2891 and 3682 of clone B0395. mir-84 is at 3351-3330 in B0395.|"Strong retarded heterochronic phenotype, reiteration of L2-stage program resulting in extra seam cells and failure to generate alae. Vul. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA)."
Proper citation: RRID:WB-STRAIN:WBStrain00040230 Copy
http://www.wormbase.org/db/get?name=WBStrain00040237
Source Database: WormBase (WB)
Affected Genes: WBGene00012435(flh-1)
Genomic Alteration: WBGene00012435(flh-1)
Availability: available
Source References: EMPTY
Synonyms: flh-1(bc374) IV.
Alternate IDs: WB-STRAIN:VT1343, CGC_VT1343
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00040237 Copy
http://www.wormbase.org/db/get?name=WBStrain00040239
Source Database: WormBase (WB)
Affected Genes: WBGene00003298(mir-70)
Genomic Alteration: WBGene00003298(mir-70)
Availability: available
Source References: PMID:34051205
Synonyms: mir-70(n4109) V.
Alternate IDs: WB-STRAIN:VT1362, CGC_VT1362
Notes: Deletion breakpoints are: ATTCATATTTCGATTAATAAAATTACCAAACA / CAATCCAACATAA...ATGGATACGCAGTA / AGAACAATATATGAACGATCGAAAAGTG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Made_by: Horvitz Lab Members"|"Mutagen:UV/TMP"|"WBStrain mapped, WBPaper00061619 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00040239 Copy
http://www.wormbase.org/db/get?name=WBStrain00040233
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: PMID:31307392
Synonyms: unc-119(ed3) III; maIs138.
Alternate IDs: WB-STRAIN:VT1160, CGC_VT1160
Notes: Made_by: N Martinez/M Ow|"maIs138 [mir-84p::GFP + unc-119(+)]. Wild type."
Proper citation: RRID:WB-STRAIN:WBStrain00040233 Copy
http://www.wormbase.org/db/get?name=WBStrain00040236
Source Database: WormBase (WB)
Affected Genes: WBGene00003291(mir-63)
Genomic Alteration: WBGene00003291(mir-63)
Availability: available
Source References: EMPTY
Synonyms: mir-63(n4568) X.
Alternate IDs: WB-STRAIN:VT1289, CGC_VT1289
Notes: Deletion breakpoints are: TAAAAATTCAAAGAATTGATATCTGAACA / CTACTATGCCACC...CCAAAGGGGTGG / TTTTCAACAATTTCACCACTGGCGC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Made_by: Horvitz Lab Members"
Proper citation: RRID:WB-STRAIN:WBStrain00040236 Copy
http://www.wormbase.org/db/get?name=WBStrain00040235
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: PMID:31307392
Synonyms: unc-119(ed3) III; maIs150.
Alternate IDs: WB-STRAIN:VT1259, CGC_VT1259
Notes: Made_by: N Martinez/M Ow|"maIs150 [mir-48p::GFP + unc-119(+)]. Wild type."
Proper citation: RRID:WB-STRAIN:WBStrain00040235 Copy
http://www.wormbase.org/db/get?name=WBStrain00040241
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; maIs162.
Alternate IDs: WB-STRAIN:VT1379, CGC_VT1379
Notes: Made_by: N Martinez/M Ow|"maIs162 [mir-59p::GFP + unc-119(+)]. Wild type."
Proper citation: RRID:WB-STRAIN:WBStrain00040241 Copy
http://www.wormbase.org/db/get?name=WBStrain00040240
Source Database: WormBase (WB)
Affected Genes: WBGene00016138(flh-2)
Genomic Alteration: WBGene00016138(flh-2)
Availability: available
Source References: EMPTY
Synonyms: flh-2(bc375) III.
Alternate IDs: WB-STRAIN:VT1376, CGC_VT1376
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00040240 Copy
http://www.wormbase.org/db/get?name=WBStrain00040243
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; maIs173.
Alternate IDs: WB-STRAIN:VT1470, CGC_VT1470
Notes: Made_by: N Martinez/M Ow|"maIs173 [mir-242p::GFP + unc-119(+)]. Wild type."
Proper citation: RRID:WB-STRAIN:WBStrain00040243 Copy
http://www.wormbase.org/db/get?name=WBStrain00040249
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; maIs188.
Alternate IDs: WB-STRAIN:VT1485, CGC_VT1485
Notes: Made_by: N Martinez/M Ow|"maIs188 [mir-228p::GFP + unc-119(+)]. Wild type."
Proper citation: RRID:WB-STRAIN:WBStrain00040249 Copy
http://www.wormbase.org/db/get?name=WBStrain00040244
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: PMID:39641335
Synonyms: unc-119(ed3) III; maIs177.
Alternate IDs: WB-STRAIN:VT1474, CGC_VT1474
Notes: Made_by: N Martinez/M Ow|"maIs177 [mir-243p::GFP + unc-119(+)]. Wild type."
Proper citation: RRID:WB-STRAIN:WBStrain00040244 Copy
http://www.wormbase.org/db/get?name=WBStrain00040219
Source Database: WormBase (WB)
Affected Genes: WBGene00006772(unc-36)
Genomic Alteration: WBGene00006772(unc-36)
Availability: available
Source References: PMID:37310364
Synonyms: unc-36(e251) III; maIs103.
Alternate IDs: WB-STRAIN:VT765, CGC_VT765
Notes: maIs103 [rnr::GFP + unc-36(+)].
Proper citation: RRID:WB-STRAIN:WBStrain00040219 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.