Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00040769
Source Database: WormBase (WB)
Affected Genes: WBGene00003992(pgl-1)|WBGene00014208(znfx-1)
Genomic Alteration: WBGene00003992(pgl-1), WBGene00014208(znfx-1)
Availability: available
Source References: PMID:33438773, PMID:37749091
Synonyms: znfx-1(gg544[3xflag::gfp::znfx-1]) II; pgl-1(gg547[pgl-1::3xflag::tagRFP]) IV.
Alternate IDs: WB-STRAIN:YY968, CGC_YY968
Notes: 3xflag::gfp inserted into endogenous znfx-1 locus, and 3xflag::tagRFP inserted into endogenous pgl-1 locus using CRISPR/Cas9 engineering. Reference: Wan G, et al. Nature. 2018 May;557(7707):679-683.
Proper citation: RRID:WB-STRAIN:WBStrain00040769 Copy
http://www.wormbase.org/db/get?name=WBStrain00040731
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; vrEx6.
Alternate IDs: WB-STRAIN:YL206, CGC_YL206
Notes: vrEx6 [nst-1p::nst-1::GFP::nst-1 3' UTR + unc-119(+)]. Stable array; high transmission rate and low percentage of mosaicism. Maintain by picking wild-type. Reference: Kudron et al. (2008) PLos Genet 4(8):e1000181.
Proper citation: RRID:WB-STRAIN:WBStrain00040731 Copy
http://www.wormbase.org/db/get?name=WBStrain00040714
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00010056(smc-6)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00010056(smc-6)
Availability: available
Source References: PMID:39115289
Synonyms: smc-6(ok3294)/mIn1 [mIs14 dpy-10(e128)] II.
Alternate IDs: WB-STRAIN:YE58, CGC_YE58
Notes: Homozygous viable mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3294 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. ok3294 homozygotes are morphologically wild-type but show ~30% reduction in fertilized eggs and a trans-generational increase in sterility. Maintain under normal conditions. Reference: Bickel JS, et al. PLoS Genet. 2010 Jul 22;6(7):e1001028.|"Made_by: Jeremy Bickel"
Proper citation: RRID:WB-STRAIN:WBStrain00040714 Copy
http://www.wormbase.org/db/get?name=WBStrain00040793
Source Database: WormBase (WB)
Affected Genes: WBGene00001620(glt-1)|WBGene00001621(glt-3)
Genomic Alteration: WBGene00001620(glt-1), WBGene00001621(glt-3)
Availability: available
Source References: PMID:31306683
Synonyms: glt-3(bz34) IV; glt-1(ok206) X.
Alternate IDs: WB-STRAIN:ZB1106, CGC_ZB1106
Notes: Reference: Mano et al. (2007) J Biol Chem 282(47):34412-9.
Proper citation: RRID:WB-STRAIN:WBStrain00040793 Copy
http://www.wormbase.org/db/get?name=WBStrain00040712
Source Database: WormBase (WB)
Affected Genes: WBGene00007395(dcar-1)
Genomic Alteration: WBGene00007395(dcar-1)
Availability: available
Source References: EMPTY
Synonyms: dcar-1(tm2484) V.
Alternate IDs: WB-STRAIN:YC307, CGC_YC307
Notes: Defective avoidance to water-soluble repellent. Reference: Aoki R., et al. J Neurosci. 2011 Nov 16;31(46):16603-10.|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00040712 Copy
http://www.wormbase.org/db/get?name=WBStrain00040770
Source Database: WormBase (WB)
Affected Genes: WBGene00014208(znfx-1)
Genomic Alteration: WBGene00014208(znfx-1)
Availability: available
Source References: PMID:37878696
Synonyms: znfx-1(gg561) II.
Alternate IDs: WB-STRAIN:YY996, CGC_YY996
Notes: Heritable RNAi defective, germline immortality. Reference: Wan G, et al. Nature. 2018 May;557(7707):679-683.|"Supplementary_genotype znfx-1(gg561)"
Proper citation: RRID:WB-STRAIN:WBStrain00040770 Copy
http://www.wormbase.org/db/get?name=WBStrain00040772
Source Database: WormBase (WB)
Affected Genes: WBGene00014208(znfx-1)
Genomic Alteration: WBGene00014208(znfx-1)
Availability: available
Source References: PMID:37505984, PMID:37537842, PMID:39179648
Synonyms: znfx-1(gg634[HA::tagRFP::znfx-1]) II.
Alternate IDs: WB-STRAIN:YY1446, CGC_YY1446
Notes: Alt Genotype: znfx-1(gg634[HA::tagRFP::znfx-1]) II|"Contains Construct ref. Wan G. et al. Nature 2018"|"HA::tagRFP inserted into endogenous znfx-1 locus using CRISPR/Cas9 engineering. Reference: Wan G, et al. Nature. 2018 May;557(7707):679-683."|"N-terminal HA::tagRFP tag on endogenous znfx-1"
Proper citation: RRID:WB-STRAIN:WBStrain00040772 Copy
http://www.wormbase.org/db/get?name=WBStrain00040781
Source Database: WormBase (WB)
Affected Genes: WBGene00000802(crt-1)
Genomic Alteration: WBGene00000802(crt-1)
Availability: available
Source References: EMPTY
Synonyms: crt-1(bz29) V.
Alternate IDs: WB-STRAIN:ZB1028, CGC_ZB1028
Notes: Probably null calreticulin. W28 amber. Slow growth (one day developmental delay). Nearly sterile if raised at 25C. Suppresses mec-4(d)-induced neurodegeneration. Bent-head.
Proper citation: RRID:WB-STRAIN:WBStrain00040781 Copy
http://www.wormbase.org/db/get?name=WBStrain00040784
Source Database: WormBase (WB)
Affected Genes: WBGene00000802(crt-1)
Genomic Alteration: WBGene00000802(crt-1)
Availability: available
Source References: EMPTY
Synonyms: crt-1(bz50) V.
Alternate IDs: WB-STRAIN:ZB1031, CGC_ZB1031
Notes: Point mutation in G102E. No easily detected phenotype, selected for suppression of mec-4(d)-induced degeneration caused by ectopic expression of mec-4(u231) in the ventral nerve cord. Bent-head.
Proper citation: RRID:WB-STRAIN:WBStrain00040784 Copy
http://www.wormbase.org/db/get?name=WBStrain00040786
Source Database: WormBase (WB)
Affected Genes: WBGene00001621(glt-3)
Genomic Alteration: WBGene00001621(glt-3)
Availability: unknown
Source References: PMID:17681948
Synonyms: glt-3(bz34) IV.
Alternate IDs: WB-STRAIN:ZB1096
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00040786 Copy
http://www.wormbase.org/db/get?name=WBStrain00040877
Source Database: WormBase (WB)
Affected Genes: WBGene00003473(mtl-1)|WBGene00003474(mtl-2)
Genomic Alteration: WBGene00003473(mtl-1), WBGene00003474(mtl-2)
Availability: unknown
Source References: PMID:17141712, PMID:38374083
Synonyms: mtl-1(tm1770) mtl-2(gk125) V.
Alternate IDs: WB-STRAIN:ZS1
Notes: This strain is described as zs1. It should be ZS1
Proper citation: RRID:WB-STRAIN:WBStrain00040877 Copy
http://www.wormbase.org/db/get?name=WBStrain00040806
Source Database: WormBase (WB)
Affected Genes: WBGene00006575(tir-1)
Genomic Alteration: WBGene00006575(tir-1)
Availability: available
Source References: PMID:37122724, PMID:38232128
Synonyms: tir-1(qd4) III.
Alternate IDs: WB-STRAIN:ZD101, CGC_ZD101
Notes: Enhanced pathogen susceptibility. Egg laying in response to food is defective. Reference: Shivers RP et al., (2009) Cell Host Microbe 6:321-30.
Proper citation: RRID:WB-STRAIN:WBStrain00040806 Copy
http://www.wormbase.org/db/get?name=WBStrain00040808
Source Database: WormBase (WB)
Affected Genes: WBGene00004758(sek-1)
Genomic Alteration: WBGene00004758(sek-1)
Availability: available
Source References: EMPTY
Synonyms: sek-1(km4) X; qdEx8.
Alternate IDs: WB-STRAIN:ZD202, CGC_ZD202
Notes: qdEx8 [unc-119p::sek-1(cDNA)::GFP::unc-54-3' UTR + myo-2p::mStrawberry::unc-54-3' UTR]. Array rescues sek-1 in neurons. References: Shivers RP, et al. Cell Host Microbe. 2009 Oct 22;6(4):321-30.
Proper citation: RRID:WB-STRAIN:WBStrain00040808 Copy
http://www.wormbase.org/db/get?name=WBStrain00040855
Source Database: WormBase (WB)
Affected Genes: WBGene00003558(nca-2)|WBGene00006809(unc-77)
Genomic Alteration: WBGene00003558(nca-2), WBGene00006809(unc-77)
Availability: available
Source References: EMPTY
Synonyms: nca-2(gk5) III; unc-77(gk9) IV.
Alternate IDs: WB-STRAIN:ZM2960, CGC_ZM2960
Notes: Uncoordinated behaviour. Fainter, pauses quickly after stimulating touch-response by prodding or tapping plate. References: Humphry JA, et al. Curr Biol. 2007 Apr 3;17(7):624-9. Gao S, et al. Nat Commun. 2015 Feb 26;6:6323.
Proper citation: RRID:WB-STRAIN:WBStrain00040855 Copy
http://www.wormbase.org/db/get?name=WBStrain00040850
Source Database: WormBase (WB)
Affected Genes: WBGene00006364(syd-2)
Genomic Alteration: WBGene00006364(syd-2)
Availability: available
Source References: PMID:33147118
Synonyms: syd-2(ok217) X.
Alternate IDs: WB-STRAIN:ZM607, CGC_ZM607
Notes: Egl. Backward stiff and slow moving. Sluggish. Can move fast when poked. Outer pairs: F59F5.6EL1 (TTGCATCTGCAAAAGAAACG); F59F5.6ER1 (GCTCCGAACGAAAGAAGTTG). Inner pairs: F59F5.6IL1 (AATCTCTAACCATGCGGTCG); F59F5.6IR1 (CGCGGGAATTATGCCTATTA).|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"WBStrain mapped, WBPaper00060580 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00040850 Copy
http://www.wormbase.org/db/get?name=WBStrain00040860
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: hpIs202.
Alternate IDs: WB-STRAIN:ZM5488, CGC_ZM5488
Notes: hpIs202 [ceh-10p::GFP + lin-15(+)]. GFP is expressed by four neurons RID, AIY, CAN, ALA, and one sheath cell. References: Wang et al., 2015. Development 142(8):1447-57. doi: 10.1242/dev.119479. Lim et al., 2016. Elife 5. pii: e19887. doi: 10.7554/eLife.19887.
Proper citation: RRID:WB-STRAIN:WBStrain00040860 Copy
http://www.wormbase.org/db/get?name=WBStrain00040847
Source Database: WormBase (WB)
Affected Genes: WBGene00006833(unc-108)
Genomic Alteration: WBGene00006833(unc-108)
Availability: available
Source References: EMPTY
Synonyms: unc-108(n3263) I.
Alternate IDs: WB-STRAIN:ZH382, CGC_ZH382
Notes: Made_by: P Mangahas & Z Zhou|"Recessive Unc. Recessive apoptotic cell removal defect. Recessive phagosome maturation defect (inefficient and prolonged phagosome maturation process in embryos). Reference: Mangahas PM, Yu X, and Zhou Z. J Cell Biol. 2008 Jan 28;180(2):357-73."
Proper citation: RRID:WB-STRAIN:WBStrain00040847 Copy
http://www.wormbase.org/db/get?name=WBStrain00040824
Source Database: WormBase (WB)
Affected Genes: WBGene00001851(hif-1)
Genomic Alteration: WBGene00001851(hif-1)
Availability: available
Source References: PMID:32482227, PMID:36653384, PMID:37902464, PMID:38573858, PMID:38986790
Synonyms: hif-1(ia4) V.
Alternate IDs: WB-STRAIN:ZG31, CGC_ZG31
Notes: Healthy and fertile in standard lab conditions, but unable to adapt to 1% oxygen. When hif-1(+) animals are incubated in1% oxygen, >94% will complete embryogenesis and larval development. In contrast, hif-1(ia4) mutants exhibit 66% embryonic lethality and 9% larval lethality in 1% oxygen. The requirement of hif-1 is alleviated if the oxygen level is increased to 2%. The ia4 mutation is a 1231 bp deletion of the second, third, and fourth exons, which encode much of the helix-loop-helix and PAS domains. Analysis of ESTs suggests that there are at least 4 alternatively spliced hif-1 transcripts. The ia4 deletion introduces a frameshift and a premature stop in the three longest forms.|"Made_by: Jiang/Powell-Coffman"|"Reference WBPaper00059755 added based on published strain data identified by Textpresso literature search."|"Supplementary_genotype hif-1(ia4), RE666 ire-1(v33), xbp-1(tm2482)"
Proper citation: RRID:WB-STRAIN:WBStrain00040824 Copy
http://www.wormbase.org/db/get?name=WBStrain00040820
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: eif-2a(qd338) I.
Alternate IDs: WB-STRAIN:ZD1866, CGC_ZD1866
Notes: Y37E3.10. qd338 disrupts Ser49 phosphorylation site; suppresses daf-28(sa191) constitutive dauer entry phenotype. Reference: Kulalert W, et al. Genetics 2017. In press.
Proper citation: RRID:WB-STRAIN:WBStrain00040820 Copy
http://www.wormbase.org/db/get?name=WBStrain00040823
Source Database: WormBase (WB)
Affected Genes: WBGene00000096(ahr-1)
Genomic Alteration: WBGene00000096(ahr-1)
Availability: available
Source References: EMPTY
Synonyms: ahr-1(ia3) I.
Alternate IDs: WB-STRAIN:ZG24, CGC_ZG24
Notes: Homozygous viable with neuronal defects.|"WBStrain provided so WBPaper00060797 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00040823 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
