Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00005103
Source Database: WormBase (WB)
Affected Genes: WBGene00004879(smg-1)
Genomic Alteration: WBGene00004879(smg-1)
Availability: available
Synonyms: smg-1(cc546) I; dvIs179.
Alternate IDs: WB-STRAIN:CL2179, CGC_CL2179
Notes: dvIs179 [myo-3p::GFP::3' UTR(long) + rol-6(su1006)]. Maintain at 16C. Superficially wild-type Roller; expression of GFP in body wall muscles increases with temperature. References: Link CD, et al. (2006) J Biol Chem. Jan 20;281(3):1808-16. Hassan WM, et al. (2014) Neurobiology of Aging. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]|"Mutagen:Gamma radiation"
Proper citation: RRID:WB-STRAIN:WBStrain00005103 Copy
http://www.wormbase.org/db/get?name=WBStrain00005122
Source Database: WormBase (WB)
Affected Genes: WBGene00001648(goa-1)
Genomic Alteration: WBGene00001648(goa-1)
Availability: available
Source References: PMID:34622282
Synonyms: goa-1(knu751) I.
Alternate IDs: WB-STRAIN:COP1863, CGC_COP1863
Notes: Hyperactive, protruding vulva. knu751 is an A221D point mutation associated with GNAO1-associated epileptic encephalopathy. This strain may not be distributed to commercial or for-profit entities. Please contact [email protected] for more information.|"Made_by: NemaMetrix"|"WBStrain provided so WBPaper00062031 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00005122 Copy
http://www.wormbase.org/db/get?name=WBStrain00005123
Source Database: WormBase (WB)
Affected Genes: WBGene00011352(rskn-1)
Genomic Alteration: WBGene00011352(rskn-1)
Availability: available
Synonyms: rskn-1(knu796) I.
Alternate IDs: WB-STRAIN:COP1918, CGC_COP1918
Notes: Made_by: NemaMetrix|"Superficially wild-type. knu796 is a K216E point mutation mimicking a patient allele associated with Coffin-Lowry syndrome. This strain may not be distributed to commercial or for-profit entities. Please contact [email protected] for more information."
Proper citation: RRID:WB-STRAIN:WBStrain00005123 Copy
http://www.wormbase.org/db/get?name=WBStrain00005120
Source Database: WormBase (WB)
Affected Genes: WBGene00003561(ncr-1)
Genomic Alteration: WBGene00003561(ncr-1)
Availability: available
Synonyms: ncr-1(knu4) X.
Alternate IDs: WB-STRAIN:COP677, CGC_COP677
Notes: Cholesterol-sensitive. Smaller broods and sizes upon serial cholesterol deprivation. This strain may not be distributed to commercial or for-profit entities. Please contact [email protected] for more information.|"Made_by: NemaMetrix"
Proper citation: RRID:WB-STRAIN:WBStrain00005120 Copy
http://www.wormbase.org/db/get?name=WBStrain00005119
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: PMID:37039075, PMID:37118512
Synonyms: unc-119(ed3) III; knuSi221.
Alternate IDs: WB-STRAIN:COP262, CGC_COP262
Notes: fib-1 translational marker|"knuSi221 [fib-1p::fib-1(genomic)::eGFP::fib-1 3' UTR + unc-119(+)]. Single copy insertion. fib-1 promoter, genomic sequence, and 3'UTR was inserted into pCFJ151 (ttTi5606) targeting vector and inserted into ttTi5605. Allen AK, Nesmith JE, and A Golden. 2014 G3:4(12)2329-43."|"Made_by: Knudra Transgenics"
Proper citation: RRID:WB-STRAIN:WBStrain00005119 Copy
http://www.wormbase.org/db/get?name=WBStrain00005115
Source Database: WormBase (WB)
Affected Genes: WBGene00004804(skn-1)|WBGene00004879(smg-1)
Genomic Alteration: WBGene00004804(skn-1), WBGene00004879(smg-1)
Availability: available
Synonyms: smg-1(cc546) I; dvIs19 III; skn-1(zu67)/nT1 [unc-?(n754) let-?] (IV;V); dvIs27 X.
Alternate IDs: WB-STRAIN:CL6180, CGC_CL6180
Notes: dvIs19 [(pAF15) gst-4p::GFP::NLS] III. dvIs27 [myo-3p::A-Beta (1-42)::let-851 3'UTR) + rol-6(su1006)] X. Roller with weak constitutive GFP expression. Balanced strain, segregates Rol Uncs [skn-1(zu67) heterozygotes], Rol nonUncs [skn-1(zu67) homozygotes] and dead eggs. Maintain by picking Rol Uncs. Paralyzed if upshifted as larvae to 25C. References: Dostal, V and Link CD (2010) J Vis Exp. Oct 9;(44). Dostal V, Roberts CM, Link CD (2010) Genetics Nov;186(3):857-66. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]|"Mutagen:Gamma radiation"
Proper citation: RRID:WB-STRAIN:WBStrain00005115 Copy
http://www.wormbase.org/db/get?name=WBStrain00005114
Source Database: WormBase (WB)
Availability: available
Source References: PMID:37957360, PMID:39212733
Synonyms: dvIs62 X.
Alternate IDs: WB-STRAIN:CL6049, CGC_CL6049
Notes: Associated protein: Human TDP-43|"dvIs62 [snb-1p::hTDP-43/3' long UTR + mtl-2p::GFP] X. Temperature-sensitive. Maintain at 16 to minimize selection against transgene. Uncoordinated from hatching; phenotype is stronger at higher temperatures. Intestinal GFP expression. Reference: Ash PE, et al. Hum Mol Genet. 2010 Aug 15;19(16):3206-18."|"Mutagen:UV/TMP"|"Supplementary_genotype dvIs62 [snb-1p::hTDP-43/3'long UTR + mtl-2p::GFP] X"|"Transgene expression: Inducible pan-neuronal + intestine (marker)"
Proper citation: RRID:WB-STRAIN:WBStrain00005114 Copy
http://www.wormbase.org/db/get?name=WBStrain00005126
Source Database: WormBase (WB)
Affected Genes: WBGene00011050(agl-1)
Genomic Alteration: WBGene00011050(agl-1)
Availability: available
Synonyms: agl-1(knu864) II.
Alternate IDs: WB-STRAIN:COP2008, CGC_COP2008
Notes: Made_by: NemaMetrix|"Superficially wild-type. knu864 is a S1444R point mutation associated with Cori Disease. This strain may not be distributed to commercial or for-profit entities. Please contact [email protected] for more information."
Proper citation: RRID:WB-STRAIN:WBStrain00005126 Copy
http://www.wormbase.org/db/get?name=WBStrain00005124
Source Database: WormBase (WB)
Availability: available
Synonyms: K09E4.4(knu858) II.
Alternate IDs: WB-STRAIN:COP2002, CGC_COP2002
Notes: knu858 is a Y146C point mutation representative of a patient mutation associated with MPSIIIB disease. This strain may not be distributed to commercial or for-profit entities. Please contact [email protected] for more information.|"Made_by: NemaMetrix"
Proper citation: RRID:WB-STRAIN:WBStrain00005124 Copy
http://www.wormbase.org/db/get?name=WBStrain00005144
Source Database: WormBase (WB)
Affected Genes: WBGene00004862(sma-9)
Genomic Alteration: WBGene00004862(sma-9)
Availability: available
Synonyms: sma-9(qc3) X.
Alternate IDs: WB-STRAIN:CS67, CGC_CS67
Notes: Small body size. Crumpled spicules. Male ray 8-9 fusion.
Proper citation: RRID:WB-STRAIN:WBStrain00005144 Copy
http://www.wormbase.org/db/get?name=WBStrain00005145
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00004857(sma-3)
Genomic Alteration: WBGene00001864(him-5), WBGene00004857(sma-3)
Availability: available
Synonyms: sma-3(wk30) III; him-5(e1490) V; qcEx24.
Alternate IDs: WB-STRAIN:CS119, CGC_CS119
Notes: qcEx24 [GFP::sma-3 + rol-6(su1006)]. Rollers. Pick rollers to maintain. Array rescues body size phenotype. Reference: Wang J, Tokarz R, Savage-Dunn C. Development. 2002 Nov;129(21):4989-98.
Proper citation: RRID:WB-STRAIN:WBStrain00005145 Copy
http://www.wormbase.org/db/get?name=WBStrain00005143
Source Database: WormBase (WB)
Affected Genes: WBGene00004862(sma-9)
Genomic Alteration: WBGene00004862(sma-9)
Availability: available
Synonyms: sma-9(wk55) X.
Alternate IDs: WB-STRAIN:CS1, CGC_CS1
Notes: Small body size. Crumpled spicules. Male ray 8-9 fusion.
Proper citation: RRID:WB-STRAIN:WBStrain00005143 Copy
http://www.wormbase.org/db/get?name=WBStrain00005147
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00004857(sma-3)
Genomic Alteration: WBGene00001864(him-5), WBGene00004857(sma-3)
Availability: available
Synonyms: sma-3(wk30) III; him-5(e1490) V; qcEx53.
Alternate IDs: WB-STRAIN:CS211, CGC_CS211
Notes: qcEx53 [vha-6p::GFP::sma-3 + rol-6(su1006)]. Sma. Rollers. Pick rollers to maintain. Reference: Wang J, Tokarz R, Savage-Dunn C. Development. 2002 Nov;129(21):4989-98.
Proper citation: RRID:WB-STRAIN:WBStrain00005147 Copy
http://www.wormbase.org/db/get?name=WBStrain00005200
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00006377(syp-3)
Genomic Alteration: WBGene00000254(bli-4), WBGene00006377(syp-3)
Availability: available
Source References: PMID:33377003, PMID:34081106, PMID:36176234
Synonyms: syp-3(ok758)/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:CV2, CGC_CV2
Notes: Heterozygotes are WT and GFP+. Segregate syp-3(ok758) homozygotes that are non-GFP and lay mostly dead eggs; these mutants lack synaptonemal complex formation during meiosis. Homozygous hT2[bli-4 let-? qIs48] animals are inviable.|"Mutagen:UV/TMP"|"Supplementary_genotype syp-3(ok758)/hT2"|"WBStrain mapped, WBPaper00060819 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061461 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00005200 Copy
http://www.wormbase.org/db/get?name=WBStrain00005165
Source Database: WormBase (WB)
Affected Genes: WBGene00004857(sma-3)
Genomic Alteration: WBGene00004857(sma-3)
Availability: available
Source References: PMID:37500768
Synonyms: sma-3(wk30) III; qcIs55.
Alternate IDs: WB-STRAIN:CS628, CGC_CS628
Notes: no longer available from the CGC.|"qcIs55 [vha-7p::GFP::sma-3 + rol-6(su1006)]. Rollers. Transgene drives tissue-specific expression of SMA-3 in the hypodermis; rescues the small body size phenotype. Reference: Clark JF, et al. 3: GENES, GENOMES, GENETICS January 1, 2018 vol. 8 no. 1 343-351."
Proper citation: RRID:WB-STRAIN:WBStrain00005165 Copy
http://www.wormbase.org/db/get?name=WBStrain00005159
Source Database: WormBase (WB)
Affected Genes: WBGene00000083(adt-2)
Genomic Alteration: WBGene00000083(adt-2)
Availability: available
Synonyms: adt-2(wk156) X.
Alternate IDs: WB-STRAIN:CS389, CGC_CS389
Notes: Made_by: Thilini Fernando|"Sma. Reference: Fernando T, et al. Dev Biol. 2011 Apr 1;352(1):92-103."
Proper citation: RRID:WB-STRAIN:WBStrain00005159 Copy
http://www.wormbase.org/db/get?name=WBStrain00005178
Source Database: WormBase (WB)
Affected Genes: WBGene00003026(lin-41)
Genomic Alteration: WBGene00003026(lin-41)
Availability: available
Source References: PMID:37541249
Synonyms: lin-41(ma104) I.
Alternate IDs: WB-STRAIN:CT8, CGC_CT8
Notes: Dpy. Precocious heterochronic. Reduced brood size. There may be a linked Dpy mutation in this strain.|"mutator TR679"|"Supplementary_genotype lin-4 (ma104)"
Proper citation: RRID:WB-STRAIN:WBStrain00005178 Copy
http://www.wormbase.org/db/get?name=WBStrain00005189
Source Database: WormBase (WB)
Availability: available
Synonyms: smIs10 I.
Alternate IDs: WB-STRAIN:CU394, CGC_CU394
Notes: Mutagen:Gamma ray|"Mutagen:Gamma Ray"|"smIs10 [ced-3p::ced-3::GFP + rol-6(su1006)] I. Rollers. Reference: Geng X, et al. Nat Struct Mol Biol. 2008 Oct;15(10):1094-101."
Proper citation: RRID:WB-STRAIN:WBStrain00005189 Copy
http://www.wormbase.org/db/get?name=WBStrain00005186
Source Database: WormBase (WB)
Availability: available
Synonyms: zaIs2.
Alternate IDs: WB-STRAIN:CT21, CGC_CT21
Notes: zaIs2 [lin-14::GFP + rol-6(su1006)]. Rollers, though Rol is not completely penetrant, Reference: Olsson-Carter K, Slack FJ. PLoS Genet. 2010 Aug 5;6(8). pii: e1001054.
Proper citation: RRID:WB-STRAIN:WBStrain00005186 Copy
http://www.wormbase.org/db/get?name=WBStrain00005187
Source Database: WormBase (WB)
Availability: available
Synonyms: zaIs6.
Alternate IDs: WB-STRAIN:CT22, CGC_CT22
Notes: Mutagen:UV/TMP|"zaIs6 [mir-239.1p::GFP + myo-2p::DsRed]. Reference: de Lencastre A, et al. Curr Biol. 2010 Dec 21;20(24):2159-68."
Proper citation: RRID:WB-STRAIN:WBStrain00005187 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
