Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00005034
Source Database: WormBase (WB)
Affected Genes: WBGene00001078(dpy-19)|WBGene00001263(emb-9)|WBGene00001609(glp-1)|WBGene00006772(unc-36)
Genomic Alteration: WBGene00001078(dpy-19), WBGene00001263(emb-9), WBGene00001609(glp-1), WBGene00006772(unc-36)
Availability: available
Source References: PMID:9166417
Synonyms: unc-36(e251) emb-9(g23cg46)/qC1 [dpy-19(e1259) glp-1(q339)] III.
Alternate IDs: WB-STRAIN:CH1179, CGC_CH1179
Notes: Heterozygotes are WT and segregate WT, Dpy Steriles and 3-fold lethals. cg46 is a 497 bp deletion that removes the last 22 nucleotides of intron 9 and 475 nucleotides of exon 10;|"Made_by: Malini Gupta"
Proper citation: RRID:WB-STRAIN:WBStrain00005034 Copy
http://www.wormbase.org/db/get?name=WBStrain00005033
Source Database: WormBase (WB)
Affected Genes: WBGene00018943(dgn-2)
Genomic Alteration: WBGene00018943(dgn-2)
Availability: available
Synonyms: dgn-2(ok209) X.
Alternate IDs: WB-STRAIN:CH123, CGC_CH123
Notes: Animals appear wild type.|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00005033 Copy
http://www.wormbase.org/db/get?name=WBStrain00005029
Source Database: WormBase (WB)
Affected Genes: WBGene00003738(nid-1)
Genomic Alteration: WBGene00003738(nid-1)
Availability: available
Source References: PMID:38964319
Synonyms: nid-1(cg118) V.
Alternate IDs: WB-STRAIN:CH118, CGC_CH118
Notes: Made_by: J. Kramer|"Parental strain was CH1416 mut-2(r459) I; nid-1(ev608) V. Tc1 excision deletion of nid-1 was identified. In frame deletion, removes amino acids Thr53-Gln693 of NID-1. Homozygous viable and fertile, slightly reduced fertility. mut-2 was removed by outcrossing. nid-1=F54F3.1. Received new stock 1/2004 from Jim Kramer."
Proper citation: RRID:WB-STRAIN:WBStrain00005029 Copy
http://www.wormbase.org/db/get?name=WBStrain00005027
Source Database: WormBase (WB)
Availability: available
Synonyms: hIn1 [umnIs78] I.
Alternate IDs: WB-STRAIN:CGC105, CGC_CGC105
Notes: umnIs78 [myo-2p::mKate2 + NeoR, I: 12541645 (intergenic)] I. Superficially wild-type. Crossover suppressor for LGI right. Inversion includes unc-75 and unc-54. Derived by insertion of myo-2p::mKate2 transgene into hIn1 inversion in parental strain KR1949 using CRISPR/Cas9.
Proper citation: RRID:WB-STRAIN:WBStrain00005027 Copy
http://www.wormbase.org/db/get?name=WBStrain00005026
Source Database: WormBase (WB)
Affected Genes: WBGene00003289(mir-61)|WBGene00003514(myo-2)
Genomic Alteration: WBGene00003289(mir-61), WBGene00003514(myo-2)
Availability: available
Synonyms: mir-61(umn15[lox2272 myo-2p::wrmScarlet + lox511I + Lox2272]) V.
Alternate IDs: WB-STRAIN:CGC103, CGC_CGC103
Notes: Made_by: Julie Knott & Marcus Vargas|"mir-61(umn15[lox2272 myo-2p::wrmScarlet + lox511I + Lox2272]) V. Derived by CRE-meditated excision of SEC in parental strain CGC102, leaving myo-2p::wrmScarlet."
Proper citation: RRID:WB-STRAIN:WBStrain00005026 Copy
http://www.wormbase.org/db/get?name=WBStrain00005038
Source Database: WormBase (WB)
Affected Genes: WBGene00000961(dgn-1)
Genomic Alteration: WBGene00000961(dgn-1)
Availability: available
Synonyms: dgn-1(cg121) X; cgEx308.
Alternate IDs: WB-STRAIN:CH1869, CGC_CH1869
Notes: cgEx308 [dgn-1(+) + dng-1p::GFP + rol-6(su1006)]. Rollers. Pick rollers to maintain. Segregates sterile non-rollers (dgn-1 homozygotes) and fertile rollers (dgn-1 rescued). Rollers can be used to produce cg121/o; cgEx308 males that can mate.|"Made_by: Robert Johnson"
Proper citation: RRID:WB-STRAIN:WBStrain00005038 Copy
http://www.wormbase.org/db/get?name=WBStrain00005039
Source Database: WormBase (WB)
Affected Genes: WBGene00000961(dgn-1)|WBGene00017221(dgn-3)|WBGene00018943(dgn-2)
Genomic Alteration: WBGene00000961(dgn-1), WBGene00017221(dgn-3), WBGene00018943(dgn-2)
Availability: available
Source References: PMID:38177158
Synonyms: dgn-2(ok209) dgn-3(tm1092) dgn-1(cg121) X; cgEx308.
Alternate IDs: WB-STRAIN:CH1878, CGC_CH1878
Notes: cgEx308 [pJK600/dgn-1(+) + pJK602/dng-1p::GFP + rol-6(su1066)]. Rollers. Pick rollers to maintain. Segregates sterile non-rollers (dgn-2 dgn-3 dgn-1 homozygotes) and fertile rollers (dgn-1 rescued). Rollers can be used to produce cg121/o; cgEx308 males that can mate. Triple mutants resemble dgn-1 single mutants; no overt phenotype caused by dgn-2 dgn-3 mutations.
Proper citation: RRID:WB-STRAIN:WBStrain00005039 Copy
http://www.wormbase.org/db/get?name=WBStrain00005100
Source Database: WormBase (WB)
Availability: available
Source References: PMID:9751195
Synonyms: Punc-54::human Amyloid beta 1-42; mtl-2::gfp
Alternate IDs: WB-STRAIN:CL2120, CGC_CL2120
Notes: dvIs14 [(pCL12) unc-54::beta 1-42 + (pCL26) mtl-2::GFP]. mtl-2::GFP produces strong constitutive intestinal expression of GFP at all developmental stages. Expresses human AB peptide and accumulates B-amyloid fibrils. AB toxicity enhanced at higher temperatures.|"[2020-08-03T20:28:08.764Z WBPerson324] Ressurect Strain: Genotype: Punc-54::human Amyloid beta 1-42; mtl-2::gfp"
Proper citation: RRID:WB-STRAIN:WBStrain00005100 Copy
http://www.wormbase.org/db/get?name=WBStrain00005061
Source Database: WormBase (WB)
Affected Genes: WBGene00004804(skn-1)
Genomic Alteration: WBGene00004804(skn-1)
Availability: available
Synonyms: dvIs19 III; skn-1(zu67) IV/nT1 [unc-?(n754) let-?] (IV;V).
Alternate IDs: WB-STRAIN:CL691, CGC_CL691
Notes: dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP. Segregates Unc skn-1(zu67) heterozygotes, arrested eggs/larvae (nT1 homozygotes), and wild type skn-1(zu67) homozygotes (sterile). All genotypes show constitutive weak GFP expression. Upon exposure to SKN-1 inducers (e.g., azide), strong induction of GFP is observered in skn-1/+ hets; there is no induction in skn-1 homozygotes. Pick Uncs to maintain -- although this strain is nominally balanced, nT1 can break down. Reference: Dostal, V., et al. Genetics. 2010 Nov;186(3):857-66.|"Mutagen:Gamma rays"
Proper citation: RRID:WB-STRAIN:WBStrain00005061 Copy
http://www.wormbase.org/db/get?name=WBStrain00005062
Source Database: WormBase (WB)
Affected Genes: WBGene00004397(rol-6)|WBGene00004879(smg-1)
Genomic Alteration: WBGene00004397(rol-6), WBGene00004879(smg-1)
Availability: available
Source References: PMID:32966472, PMID:37726773, PMID:38983916
Synonyms: smg-1(cc546) I; rol-6(su1006) II.
Alternate IDs: WB-STRAIN:CL802, CGC_CL802
Notes: Rollers. Maintain under normal conditions. Standard control for CL4176; originally used CL1175 as the control, but subsequently it was found that CL1175 can produce some A-Beta. Reference: Fonte V., et al. Mol Neurodegener. 2011 Aug 23;6(1):61. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]|"Supplementary_genotype [smg-1(cc546) I; rol-6(su1006) II]"|"WBStrain provided so WBPaper00059477 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00005062 Copy
http://www.wormbase.org/db/get?name=WBStrain00005059
Source Database: WormBase (WB)
Affected Genes: WBGene00005157(srf-8)
Genomic Alteration: WBGene00005157(srf-8)
Availability: available
Source References: PMID:1516818
Synonyms: srf-8(dv38) V.
Alternate IDs: WB-STRAIN:CL264, CGC_CL264
Notes: Animals are somewhat smaller than WT. Often have protuding vulva. Unc(slow moving and non-sinusoidal body posture). Egl. Males are infertile and Mab. Ectopic surface binding of lectins WGA and SBA.
Proper citation: RRID:WB-STRAIN:WBStrain00005059 Copy
http://www.wormbase.org/db/get?name=WBStrain00005199
Source Database: WormBase (WB)
Affected Genes: WBGene00006808(unc-76)
Genomic Alteration: WBGene00006808(unc-76)
Availability: available
Synonyms: unc-76(e911) V; smIs380.
Alternate IDs: WB-STRAIN:CU9087, CGC_CU9087
Notes: Made_by: Jim Mapes|"Mutagen:Gamma rays"|"smIs380 [tra-2::GFP + unc-76(+)]. Some sterility. Maintain under normal conditions. Reference: Mapes J, et al. (2010) PNAS In press."
Proper citation: RRID:WB-STRAIN:WBStrain00005199 Copy
http://www.wormbase.org/db/get?name=WBStrain00005197
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00001168(eef-1A.1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001168(eef-1A.1)
Availability: available
Synonyms: eef-1A.1(q145) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:CU6493, CGC_CU6493
Notes: Heterozygotes are WT and GFP+. Segregate non-GFP steriles (q145 homozygotes). qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.
Proper citation: RRID:WB-STRAIN:WBStrain00005197 Copy
http://www.wormbase.org/db/get?name=WBStrain00005195
Source Database: WormBase (WB)
Affected Genes: WBGene00004807(skr-1)|WBGene00006808(unc-76)
Genomic Alteration: WBGene00004807(skr-1), WBGene00006808(unc-76)
Availability: available
Synonyms: skr-1(sm151) I; unc-76(e911) V.
Alternate IDs: WB-STRAIN:CU6102, CGC_CU6102
Notes: Mutagen:UV/TMP|"sm151 is a semi-dominant allele of skr-1. Maintain under normal conditions. Reference: Killian DJ, et al. (2008) Dev Biol. 322(2):322-31."
Proper citation: RRID:WB-STRAIN:WBStrain00005195 Copy
http://www.wormbase.org/db/get?name=WBStrain00005193
Source Database: WormBase (WB)
Affected Genes: WBGene00011935(scrm-1)
Genomic Alteration: WBGene00011935(scrm-1)
Availability: available
Source References: PMID:33759761
Synonyms: scrm-1(tm805) I.
Alternate IDs: WB-STRAIN:CU2945, CGC_CU2945
Notes: Made_by: X. Wang & D. Xue|"Mild defect in cell corpse engulfment."|"Mutagen:UV/TMP"|"WBStrain provided so WBPaper00061198 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00005193 Copy
http://www.wormbase.org/db/get?name=WBStrain00005190
Source Database: WormBase (WB)
Availability: available
Source References: PMID:36774344, PMID:37118512, PMID:37577954
Synonyms: smIs34.
Alternate IDs: WB-STRAIN:CU1546, CGC_CU1546
Notes: Mutagen:Gamma rays|"smIs34 [ced-1p::ced-1::GFP + rol-6(su1006)]. Maintain under standard conditions. Reference: Zou W, et al., (2009) PLoS Genet. 5(10):e1000679."
Proper citation: RRID:WB-STRAIN:WBStrain00005190 Copy
http://www.wormbase.org/db/get?name=WBStrain00005106
Source Database: WormBase (WB)
Affected Genes: WBGene00004879(smg-1)
Genomic Alteration: WBGene00004879(smg-1)
Availability: available
Source References: PMID:31797327, PMID:32966472, PMID:33466350, PMID:35018947, PMID:37549461, PMID:38274404, PMID:38500791, PMID:38983916, PMID:39212733
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:CL2355, CGC_CL2355
Notes: Associated protein: Human A peptide|"dvIs50 [pCL45 (snb-1::Abeta 1-42::3' UTR(long) + mtl-2::GFP] I. Maintain at 16C. Pan-neuronal expresion of human Abeta peptide. Constitutive intestinal expression of GFP from marker transgene. Strain shows deficits in chemotaxis, associative learning, and thrashing in liquid. Strain also has incomplete sterility due to germline proliferation defects and embryonic lethality. Maintain at 16 C to reduce selection against transgene, although this does not alter the partial sterility. Reference: Wu Y., et al. J Neurosci. 2006 Dec 13;26(50):13102-13. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]"|"Mutagen:Gamma rays"|"Transgene expression: Inducible pan-neuronal + intestine (marker)"|"[2020-08-03T20:49:03.516Z WBPerson324] Ressurect Strain: Genotype: smg-1(cc546); pCL45 [Psnb-1::human Amyloid beta 1-42::3' UTR (long); Pmtl-2::GFP]"
Proper citation: RRID:WB-STRAIN:WBStrain00005106 Copy
http://www.wormbase.org/db/get?name=WBStrain00005104
Source Database: WormBase (WB)
Availability: available
Source References: PMID:35018947, PMID:37549461, PMID:37239029, PMID:38983916
Synonyms: dvIs37.
Alternate IDs: WB-STRAIN:CL2331, CGC_CL2331
Notes: dvIs37 [myo-3p::GFP::A-Beta (3-42) + rol-6(su1006)]. Maintain at 16C. Roller. Diffuse and aggregated GFP expression in body wall muscle. Low brood size. Sicker at higher temperatures (e.g. 25C). Reference: Link CD, et al. (2008) Neurobiology of Disease,32(3):420-5.|"expresses the human A3-42 peptide fused to green fluorescent protein (GFP) in its body-wall muscle cells"|"Mutagen:Gamma radiation"
Proper citation: RRID:WB-STRAIN:WBStrain00005104 Copy
http://www.wormbase.org/db/get?name=WBStrain00005105
Source Database: WormBase (WB)
Affected Genes: WBGene00004879(smg-1)
Genomic Alteration: WBGene00004879(smg-1)
Availability: available
Synonyms: smg-1(cc546) I; dvIs38.
Alternate IDs: WB-STRAIN:CL2337, CGC_CL2337
Notes: dvIs38 [myo-3p::GFP::degron::3' UTR(long) + rol-6(su1006)]. Maintain at 16C. Rollers. Temperature-dependent expression of aggregating GFP in body wall muscle (weak at 16C, strong at 25C). Animals become paralyzed if upshifted as larvae to 25C due to expression of aggregating GFP. References: Link CD, et al. (2006) J Biol Chem. Jan 20;281(3):1808-16. Hassan WM, et al. (2014) Neurobiology of Aging. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]|"Mutagen:Gamma radiation"
Proper citation: RRID:WB-STRAIN:WBStrain00005105 Copy
http://www.wormbase.org/db/get?name=WBStrain00005102
Source Database: WormBase (WB)
Affected Genes: WBGene00001752(gst-4)
Genomic Alteration: WBGene00001752(gst-4)
Availability: available
Source References: PMID:12757851, PMID:29956725, PMID:31409866, PMID:31432005, PMID:31510078, PMID:31717869, PMID:31735670, PMID:32294300, PMID:32600387, PMID:33008901, PMID:32163353, PMID:33471780, PMID:33789349, PMID:33809299, PMID:33883621, PMID:34505574, PMID:35602005, PMID:36791646, PMID:37099597, PMID:37416472, PMID:37427543, PMID:37488107, PMID:37549461, PMID:37606250, PMID:37726773, PMID:37751046, PMID:37902464, PMID:37910615, PMID:38632209, PMID:38799567, PMID:38754743, PMID:38889876, PMID:38983916, PMID:38991033, PMID:39169052, PMID:39164296, PMID:39264947, PMID:39097626, PMID:39420966, PMID:39561954, PMID:39560153
Synonyms: dvIs19 [(pAF15)gst-4p::GFP::NLS] III.
Alternate IDs: WB-STRAIN:CL2166, CGC_CL2166
Notes: dvIs19 [(pAF15)gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP.|"Reference WBPaper00054805 added based on published strain data identified by Textpresso literature search."|"Reference WBPaper00057197 added based on published strain data identified by Textpresso literature search."|"Reference WBPaper00057259 added based on published strain data identified by Textpresso literature search."|"Reference WBPaper00058621 added based on published strain data identified by Textpresso literature search."|"Reference WBPaper00058851 added based on published strain data identified by Textpresso literature search."|"Supplementary_genotype (dvIs19[pAF15(gst-4::GFP::NLS)])"|"Supplementary_genotype dvIs19 [(pAF15)gst-4p::GFP::NLS] III"|"Supplementary_genotype dvIs19[(pAF15)gst-4p::GFP::NLS]"|"Supplementary_genotype gst-4::GFP dvIs19 [(pAF15)gst-4p::GFP::NLS] III"|"Supplementary_genotype gst-4p::GFP"|"WBStrain mapped, WBPaper00059548 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060449 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060456 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060486 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060545 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060669 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060692 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060778 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060797 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060840 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060896 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060924 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00060976 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061045 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061159 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061220 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061236 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061385 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061436 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061452 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061495 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061547 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061584 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061641 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061671 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061869 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061871 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061890 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061895 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061902 added based on AFP_Strain data."|"WBStrain provided so WBPaper00059545 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00060797 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00005102 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.