Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
CGC64 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00004994 | Caenorhabditis elegans | unc-30(e191) dpy-4(e1166) IV; yDp1 [umnIs50] (IV;V;f). | umnIs50 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)]. Animals with the Dup are wild-type mKate2+; animals that have lost the Dup are Dpy Unc mKate2-. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into yDp1 duplication in parental strain TY156 using CRISPR/Cas9. | WBGene00001066(dpy-4)|WBGene00006766(unc-30) | WBGene00001066(dpy-4), WBGene00006766(unc-30) | WB-STRAIN:WBStrain00004994 | WormBase (WB) | WB | available | WB-STRAIN:CGC64, CGC_CGC64 | WormBase | 2026-09-26 11:21:43 | 0 | |||
|
CGC63 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00004993 | Caenorhabditis elegans | unc-5(e53)/nT1 [umnIs49] IV; dpy-11(e224)/nT1 V. | umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc, Vul mKate2+ (nT1) and dead eggs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9. | WBGene00001073(dpy-11)|WBGene00006745(unc-5) | WBGene00001073(dpy-11), WBGene00006745(unc-5) | WB-STRAIN:WBStrain00004993 | WormBase (WB) | WB | available | WB-STRAIN:CGC63, CGC_CGC63 | WormBase | 2026-09-26 11:21:43 | 0 | |||
|
CG490 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00004929 | Caenorhabditis elegans | unc-103(n1213) III; egl-2(rg4) him-5(e1490) V; rgEx173. | rgEx173 [unc-103ep::egl-2(cDNA) + gtl-1p::CFP]. Pick animals with cyan fluorescence in their intestines. rgEx173 rescues food deprivation's ability to suppress unc-103(n1213)-induced male sex muscle seizures. | WBGene00001171(egl-2)|WBGene00001864(him-5)|WBGene00006830(unc-103) | WBGene00001171(egl-2), WBGene00001864(him-5), WBGene00006830(unc-103) | WB-STRAIN:WBStrain00004929 | WormBase (WB) | WB | available | WB-STRAIN:CG490, CGC_CG490 | WormBase | 2026-09-26 11:21:42 | 0 | |||
|
CG460 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00004928 | Caenorhabditis elegans | unc-43(sy574) IV; him-5(e1490) V; rgEx161. | rgEx161[lev-11p::UNC-43g + gtl-1p::CFP]. rgEx161 rescues unc-43(sy574)-induced spicule protraction. | WBGene00001864(him-5)|WBGene00006779(unc-43) | WBGene00001864(him-5), WBGene00006779(unc-43) | WB-STRAIN:WBStrain00004928 | WormBase (WB) | WB | available | WB-STRAIN:CG460, CGC_CG460 | WormBase | 2026-09-26 11:21:42 | 0 | |||
|
CG118 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00004925 | Caenorhabditis elegans | unc-43(sy574) IV; him-5(e1490) V. | Males constitutively protract their spicules in the absence of mating cues. | WBGene00001864(him-5)|WBGene00006779(unc-43) | WBGene00001864(him-5), WBGene00006779(unc-43) | WB-STRAIN:WBStrain00004925 | WormBase (WB) | WB | available | WB-STRAIN:CG118, CGC_CG118 | WormBase | 2026-09-26 11:21:42 | 0 | |||
|
CF3166 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00004920 | Caenorhabditis elegans | muEx473. | muEx473 [kin-19p::kin-19::tagRFP + tph-1p::GFP]. Pick RFP+ GFP+ animals to maintain. Low transmission rate. Translational fusion of KIN-19 displaying age-dependent aggregation. Reference: David DC, et al. PLoS Biol. 2010 Aug 10;8(8):e1000450. | WB-STRAIN:WBStrain00004920 | WormBase (WB) | WB | available | PMID:37708127 | WB-STRAIN:CF3166, CGC_CF3166 | WormBase | 2026-09-26 11:21:42 | 0 | ||||
|
CGC72 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00005002 | Caenorhabditis elegans | npr-23(umn5[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. | Homozygous viable. Deletion of 280 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAGGCGTCATCTGGAGAGAAGAACGAAgtg ; Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 280 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: AAGGCGTCATCTGGAGAGAAGAACGAAgtg ; Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of npr-23. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: cccctgcctctggctcccacaaggcgtcatctggagagaagaacgaagtg Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGCGTTGCTCGTATTGGTGCCGG" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00021328(npr-23) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00021328(npr-23) | WB-STRAIN:WBStrain00005002 | WormBase (WB) | WB | available | WB-STRAIN:CGC72, CGC_CGC72 | WormBase | 2026-09-26 11:21:43 | 2 | |||
|
CGC84 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005013 | Caenorhabditis elegans | umnIs65 V. | Made_by: Emily Lorenz-Mueller|"umnIs65 [myo-2p::mKate2 + NeoR, V:4308261 (intergenic)] V. Derived by insertion of myo-2p::mKate2 transgene into parental strain N2 using CRISPR/Cas9." | WB-STRAIN:WBStrain00005013 | WormBase (WB) | WB | available | WB-STRAIN:CGC84, CGC_CGC84 | WormBase | 2026-09-26 11:21:43 | 0 | |||||
|
CL2006 Resource Report Resource Website 10+ mentions |
RRID:WB-STRAIN:WBStrain00005094 | Caenorhabditis elegans | dvIs2 [Punc-54::human A-beta 3-42; pRF4 (rol-6(su1006] | dvIs2 [pCL12(unc-54/human Abeta peptide 1-42 minigene) + rol-6(su1006)]. Temperature-sensitive. Maintain at 15C. Adult onset paralysis and egg-laying deficiency when raised at 20C. A few animals will be paralyzed even at permissive temperatures. Received new stock from CL 8/2005.|"WBStrain provided so WBPaper00059477 paper added based on AFP_Strain data."|"WBStrain provided so WBPaper00062076 paper added based on AFP_Strain data."|"[2020-08-03T18:23:09.013Z WBPerson324] Ressurect Strain: Paper: WBPaper00002289 Genotype: dvIs2 [Punc-54::human A-beta 3-42; pRF4 (rol-6(su1006]" | WBGene00006789(unc-54) | WBGene00006789(unc-54) | WB-STRAIN:WBStrain00005094 | WormBase (WB) | WB | available | PMID:7568134 PMID:9751195 PMID:32966472 PMID:34707479 PMID:36226991 PMID:36653384 PMID:37103980 PMID:37522064 PMID:37113386 PMID:37549461 PMID:38983916 PMID:38991033 PMID:39950089 |
WB-STRAIN:CL2006, CGC_CL2006 | WormBase | 2026-09-26 11:21:44 | 15 | ||
|
CL2008 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005095 | Caenorhabditis elegans | unc-54p::human transthyretin::rol-6 (su1006) | dvIs3 [unc-54p::human transthyretin + rol-6(su1006)]. Rollers. Him. Expression of wild-type human transthyretin (TTR) in body wall muscles. Transthyretin is secreted from the muscles into the pseudocoelom and concentrates in the coelomocytes. Reference: Link CD (1995) Proc Natl Acad Sci U S A 92:9368-9372.|"Mutagen:Gamma radiation"|"[2020-08-03T20:19:01.738Z WBPerson324] Ressurect Strain: WBPaper00002289 Genotype: unc-54p::human transthyretin::rol-6 (su1006)" | WBGene00001864(him-5) | WBGene00001864(him-5) | WB-STRAIN:WBStrain00005095 | WormBase (WB) | WB | available | PMID:7568134 | WB-STRAIN:CL2008, CGC_CL2008 | WormBase | 2026-09-26 11:21:44 | 0 | ||
|
CGC78 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005007 | Caenorhabditis elegans | C04C3.6(umn8[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. | Homozygous viable. Deletion of 1123 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaaaatcaactatttttaatgaaaatttca ; Right flanking sequence: TGGTCACTTTACCTGCGTTGATATTCATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 1123 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: aaaaatcaactatttttaatgaaaatttca ; Right flanking sequence: TGGTCACTTTACCTGCGTTGATATTCATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"|"Superficially wild-type. CRISPR/Cas9 deletion of C04C3.6. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: ttgaaaatttgaaatttgaaaaaaatcaactatttttaatgaaaatttca Right flanking sequence: TGGTCACTTTACCTGCGTTGATATTCATGTTCATCGTGCTTCGAAAGTAC" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00005007 | WormBase (WB) | WB | available | WB-STRAIN:CGC78, CGC_CGC78 | WormBase | 2026-09-26 11:21:43 | 0 | |||
|
CGC79 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005008 | Caenorhabditis elegans | +/szT1 [lon-2(e678) umnIs61] I; dpy-8(e1321) unc-3(e151)/szT1 X. | umnIs61 [myo-2p::mKate2 + NeoR, X: 15420938 (intergenic)] I. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc non-mKate2, dead eggs and mKate2+ Lon males. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into szT1 balancer in parental strain AF1 using CRISPR/Cas9. | WBGene00001070(dpy-8)|WBGene00003056(lon-2)|WBGene00006743(unc-3) | WBGene00001070(dpy-8), WBGene00003056(lon-2), WBGene00006743(unc-3) | WB-STRAIN:WBStrain00005008 | WormBase (WB) | WB | available | WB-STRAIN:CGC79, CGC_CGC79 | WormBase | 2026-09-26 11:21:43 | 0 | |||
|
CGC76 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005005 | Caenorhabditis elegans | umnIs59 I. | umnIs59 [myo-2p::mKate2 + NeoR, I:6284001(intergenic)] I. Derived by insertion of myo-2p::mKate2 transgene into parental strain N2 using CRISPR/Cas9. | WB-STRAIN:WBStrain00005005 | WormBase (WB) | WB | available | WB-STRAIN:CGC76, CGC_CGC76 | WormBase | 2026-09-26 11:21:43 | 0 | |||||
|
CGC75 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005004 | Caenorhabditis elegans | unc-13(e51)/hT1 [umnIs58] I; dpy-11(e224)/hT1 [unc-42(e270)] V. | umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Pick wild-type mKate2+ to maintain. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc, arrested hT1 homozygotes (mKate2+), and dead eggs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into hT1 balancer in parental strain KR1037 using CRISPR/Cas9. | WBGene00001073(dpy-11)|WBGene00006752(unc-13)|WBGene00006778(unc-42) | WBGene00001073(dpy-11), WBGene00006752(unc-13), WBGene00006778(unc-42) | WB-STRAIN:WBStrain00005004 | WormBase (WB) | WB | available | WB-STRAIN:CGC75, CGC_CGC75 | WormBase | 2026-09-26 11:21:43 | 0 | |||
|
CGC92 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005021 | Caenorhabditis elegans | dpy-5(e61)/hT2 [umnIs73] I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661)] III. | umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Heterozygotes are WT mKate2+ and segregate WT mKate2+, DpyUnc, lethal mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional mKate+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT mKate2+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::mKate2 transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] | WBGene00000254(bli-4)|WBGene00001067(dpy-5)|WBGene00006772(unc-36) | WBGene00000254(bli-4), WBGene00001067(dpy-5), WBGene00006772(unc-36) | WB-STRAIN:WBStrain00005021 | WormBase (WB) | WB | available | WB-STRAIN:CGC92, CGC_CGC92 | WormBase | 2026-09-26 11:21:44 | 0 | |||
|
CGC93 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005022 | Caenorhabditis elegans | umnIs74 X. | umnIs74 [myo-2p::mKate2 + NeoR, X: 15420938 (intergenic)] X. Derived by insertion of myo-2p::mKate2 transgene into parental strain N2 using CRISPR/Cas9. | WB-STRAIN:WBStrain00005022 | WormBase (WB) | WB | available | WB-STRAIN:CGC93, CGC_CGC93 | WormBase | 2026-09-26 11:21:44 | 0 | |||||
|
CGC91 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005020 | Caenorhabditis elegans | umnIs72 I. | umnIs72 [myo-2p::GFP + NeoR, I:6284001 (intergenic)] I. Derived by insertion of myo-2p::GFP transgene into parental strain N2 using CRISPR/Cas9. | WB-STRAIN:WBStrain00005020 | WormBase (WB) | WB | available | WB-STRAIN:CGC91, CGC_CGC91 | WormBase | 2026-09-26 11:21:44 | 0 | |||||
|
CGC90 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005019 | Caenorhabditis elegans | unc-3(e151) X; mnDp3 [umnIs71] (X;f). | No longer available from the CGC|"umnIs71 [myo-2p::mKate2 + NeoR, X: 15420938 (intergenic)]. Pick wild-type mKate2+ to maintain. Segregates wild-type mKate2+ and Unc mKate2-. Derived by insertion of myo-2p::mKate2 transgene into mnDp3 duplication in parental strain SP123 using CRISPR/Cas9." | WBGene00006743(unc-3) | WBGene00006743(unc-3) | WB-STRAIN:WBStrain00005019 | WormBase (WB) | WB | available | WB-STRAIN:CGC90, CGC_CGC90 | WormBase | 2026-09-26 11:21:44 | 0 | |||
|
CGC88 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005017 | Caenorhabditis elegans | tmIn26 [umnIs70] X. | Made_by: Emily Lorenz-Mueller|"umnIs70 [myo-2p::GFP + NeoR, X:6745526(intergenic)] X. tmIn26 homozygotes are Lon and Mec. Break points: In(lon-2 mec-10) X. Covered region (Mb) 3.7 (4.7..8.5) Lon Mec. Derived by insertion of myo-2p::GFP transgene into parental strain FX19171 using CRISPR/Cas9." | WB-STRAIN:WBStrain00005017 | WormBase (WB) | WB | available | WB-STRAIN:CGC88, CGC_CGC88 | WormBase | 2026-09-26 11:21:44 | 0 | |||||
|
CGC86 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00005015 | Caenorhabditis elegans | dpy-5(e61)/hT2 I; unc-36(e251)/hT2 [bli-4(e937) let-?(h661) umnIs67] III. | umnIs67 [myo-2p::GFP + NeoR, I: 6284001 (intergenic)] III. Heterozygotes are WT GFP+ and segregate WT GFP+, DpyUnc, lethal GFP+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional GFP+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT GFP+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::GFP transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] | WBGene00000254(bli-4)|WBGene00001067(dpy-5)|WBGene00006772(unc-36) | WBGene00000254(bli-4), WBGene00001067(dpy-5), WBGene00006772(unc-36) | WB-STRAIN:WBStrain00005015 | WormBase (WB) | WB | available | WB-STRAIN:CGC86, CGC_CGC86 | WormBase | 2026-09-26 11:21:43 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
