Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00030893
Source Database: WormBase (WB)
Affected Genes: WBGene00000429(ceh-2)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00000429(ceh-2), WBGene00006843(unc-119)
Availability: available
Source References: PMID:26024448
Synonyms: syIs54 II; unc-119(ed4) III.
Alternate IDs: WB-STRAIN:PS3504, CGC_PS3504
Notes: syIs54 [ceh-2::GFP + unc-119(+)]. WT phenotype. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
Proper citation: RRID:WB-STRAIN:WBStrain00030893 Copy
http://www.wormbase.org/db/get?name=WBStrain00030816
Source Database: WormBase (WB)
Affected Genes: WBGene00006829(unc-101)
Genomic Alteration: WBGene00006829(unc-101)
Availability: available
Source References: PMID:8288128, PMID:37053235, PMID:38302462
Synonyms: unc-101(sy108) I.
Alternate IDs: WB-STRAIN:PS529, CGC_PS529
Notes: Made_by: Greg Jongeward|"Unc. Suppresses the Vul phenotypes of let-23(lf) mutants. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."
Proper citation: RRID:WB-STRAIN:WBStrain00030816 Copy
http://www.wormbase.org/db/get?name=WBStrain00030884
Source Database: WormBase (WB)
Affected Genes: WBGene00000395(cdh-3)
Genomic Alteration: WBGene00000395(cdh-3)
Availability: available
Source References: PMID:9012534
Synonyms: syIs50.
Alternate IDs: WB-STRAIN:PS3352, CGC_PS3352
Notes: Made_by: Dave Sherwood|"syIs50 [cdh-3::GFP + dpy-20(+)]. Line is a slightly Dpy, but appears healthy. Reference: Pettitt J, et al. Development. 1996 Dec;122(12):4149-57. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."
Proper citation: RRID:WB-STRAIN:WBStrain00030884 Copy
http://www.wormbase.org/db/get?name=WBStrain00030803
Source Database: WormBase (WB)
Affected Genes: WBGene00000481(cha-1)
Genomic Alteration: WBGene00000481(cha-1)
Availability: available
Source References: PMID:6698395
Synonyms: cha-1(p503) IV.
Alternate IDs: WB-STRAIN:PR1162, CGC_PR1162
Notes: Mild (leaky) allele of cha-1. Has approximately 10% WT ChAT activity. Behaviorally normal-normal growth and development. Males mate. Sensitive to cholinesterase inhibitor aldicarb.
Proper citation: RRID:WB-STRAIN:WBStrain00030803 Copy
http://www.wormbase.org/db/get?name=WBStrain00030851
Source Database: WormBase (WB)
Availability: available
Source References: PMID:33820969, PMID:34622777, PMID:38564369
Synonyms: wild
Alternate IDs: WB-STRAIN:PS2025, CGC_PS2025
Notes: Isolated by John Demodena (Caltech) in his garden in Altadena, CA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
Proper citation: RRID:WB-STRAIN:WBStrain00030851 Copy
http://www.wormbase.org/db/get?name=WBStrain00030955
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00004038(plc-3)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00004038(plc-3)
Availability: available
Source References: PMID:36924492
Synonyms: plc-3(tm1340)/mIn1 [mIs14 dpy-10(e128)] II.
Alternate IDs: WB-STRAIN:PS4886, CGC_PS4886
Notes: Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP tm1340 homozygotes (sterile). This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Mutagen:UV/TMP"|"Supplementary_genotype plc-3(tm1340)/mIn1 [mIs14 dpy-10(e128)] II"
Proper citation: RRID:WB-STRAIN:WBStrain00030955 Copy
http://www.wormbase.org/db/get?name=WBStrain00030970
Source Database: WormBase (WB)
Availability: available
Source References: PMID:33440164, PMID:37258276, PMID:37769660, PMID:38446031, PMID:38548742
Synonyms: qrIs2.
Alternate IDs: WB-STRAIN:PS6025, CGC_PS6025
Notes: qrIs2 [sra-9::mCasp1]. Caspase expression in ASK neuron.|"Supplementary_genotype -ASK: qrIs2[sra-9::mCasp1]"|"Supplementary_genotype qrIs2[sra-9::mCasp1]"|"WBStrain mapped, WBPaper00060871 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00030970 Copy
http://www.wormbase.org/db/get?name=WBStrain00030975
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00004010(pha-1)
Genomic Alteration: WBGene00001864(him-5), WBGene00004010(pha-1)
Availability: unknown
Source References: PMID:34429473
Synonyms: pha-1(e2123) III; him-5(e1490) V; syEx1240.
Alternate IDs: WB-STRAIN:PS6374
Notes: syEx1240 [str-2p::GCaMP3 + pha-1(+)]. Expression of GCaMP3 calcium indicator in the AWCon neuron. Reference: Zaslaver et al. Proc Natl Acad Sci U S A. 2015 Mar 31;112(13):E1688-9.|"WBStrain provided so WBPaper00061836 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00030975 Copy
http://www.wormbase.org/db/get?name=WBStrain00030974
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: syIs243.
Alternate IDs: WB-STRAIN:PS6192, CGC_PS6192
Notes: syIs243 [myo-3p::TOM20::mRFP + unc-119(+) + pBS Sk+]. Integrated from PS6053. Strain has been outcrossed, but not known if unc-119 mutation is still present in the background.
Proper citation: RRID:WB-STRAIN:WBStrain00030974 Copy
http://www.wormbase.org/db/get?name=WBStrain00030973
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00004010(pha-1)|WBGene00006843(unc-119)
Genomic Alteration: WBGene00001864(him-5), WBGene00004010(pha-1), WBGene00006843(unc-119)
Availability: available
Source References: PMID:37427543
Synonyms: pha-1(e2123) unc-119(ed4) III; syEx1155.
Alternate IDs: WB-STRAIN:PS6187, CGC_PS6187
Notes: syEx1155 [myo-3p::tomm-20::mRFP::3xMyc + Cbr-unc-119(+)]. Maintain at 15C. Pick non-Unc to maintain array.|"syEx1155 [myo-3p::tomm-20::mRFP::3xMyc]. Maintain at 15C. Pick non-Unc to maintain array."
Proper citation: RRID:WB-STRAIN:WBStrain00030973 Copy
http://www.wormbase.org/db/get?name=WBStrain00030987
Source Database: WormBase (WB)
Availability: available
Source References: PMID:38869949, PMID:39738055
Synonyms: syIs321 I.
Alternate IDs: WB-STRAIN:PS6936, CGC_PS6936
Notes: Made_by: Han Wang and Jonathan Liu|"syIs321 [myo-3p::NLS::GAL4SK::VP64::unc-54"|"syIs321 [myo-3p::NLS::GAL4SK::VP64::unc-543'UTR + myo-2p::NLS::mCherry + pBlueScript]. myo-3 cGAL driver for body wall muscle. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148."
Proper citation: RRID:WB-STRAIN:WBStrain00030987 Copy
http://www.wormbase.org/db/get?name=WBStrain00031085
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:38771761
Synonyms: dpy-10 (kah82)II.
Alternate IDs: WB-STRAIN:PTM229
Notes: Information on this strain can be found in the following publication : https://www.biorxiv.org/content/early/2018/04/30/309997
Proper citation: RRID:WB-STRAIN:WBStrain00031085 Copy
http://www.wormbase.org/db/get?name=WBStrain00031067
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00011261(nphp-4)
Genomic Alteration: WBGene00001864(him-5), WBGene00011261(nphp-4)
Availability: available
Source References: EMPTY
Synonyms: nphp-4(tm925) him-5(e1490) V.
Alternate IDs: WB-STRAIN:PT709, CGC_PT709
Notes: Made_by: A. Jauregui|"Superficially WT."
Proper citation: RRID:WB-STRAIN:WBStrain00031067 Copy
http://www.wormbase.org/db/get?name=WBStrain00031065
Source Database: WormBase (WB)
Affected Genes: WBGene00001463(flp-20)
Genomic Alteration: WBGene00001463(flp-20)
Availability: available
Source References: PMID:39024405
Synonyms: flp-20(pk1596) X.
Alternate IDs: WB-STRAIN:PT505, CGC_PT505
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00031065 Copy
http://www.wormbase.org/db/get?name=WBStrain00031064
Source Database: WormBase (WB)
Affected Genes: WBGene00001451(flp-8)
Genomic Alteration: WBGene00001451(flp-8)
Availability: available
Source References: PMID:39024405
Synonyms: flp-8(pk360) X.
Alternate IDs: WB-STRAIN:PT501, CGC_PT501
Notes: Reference: Liu T, et al. J Neurosci. 2007 Jul 4;27(27):7174-82.
Proper citation: RRID:WB-STRAIN:WBStrain00031064 Copy
http://www.wormbase.org/db/get?name=WBStrain00031063
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00002218(klp-6)
Genomic Alteration: WBGene00001864(him-5), WBGene00002218(klp-6)
Availability: available
Source References: EMPTY
Synonyms: klp-6(sy511) III; him-5(e1490) V.
Alternate IDs: WB-STRAIN:PT442, CGC_PT442
Notes: Males Lov and response defective. Mislocalizes pkd-2::GFP in cilia. sy511 contains a nonsense mutation in exon 10 (C-T transition = Q706stop).
Proper citation: RRID:WB-STRAIN:WBStrain00031063 Copy
http://www.wormbase.org/db/get?name=WBStrain00031070
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00086546(inpp-5K)
Genomic Alteration: WBGene00001864(him-5), WBGene00086546(inpp-5K)
Availability: available
Source References: EMPTY
Synonyms: inpp-5K(my15) III; him-5(e1490) V.
Alternate IDs: WB-STRAIN:PT1443, CGC_PT1443
Notes: Spermatogenesis abnormal with small brood size. PKD-2::GFP ciliary localization defective. Maintain at 20 C. inpp-5K formerly known as cil-1. Reference: Bae Y, et al. 2009 Curr Bio 19(19):1599-607.
Proper citation: RRID:WB-STRAIN:WBStrain00031070 Copy
http://www.wormbase.org/db/get?name=WBStrain00031058
Source Database: WormBase (WB)
Affected Genes: WBGene00011227(nlp-67)
Genomic Alteration: WBGene00011227(nlp-67)
Availability: available
Source References: PMID:30224336
Synonyms: nlp-67(sy1176) X.
Alternate IDs: WB-STRAIN:PS8027, CGC_PS8027
Notes: Made_by: Heenam Park|"STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc"|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-67; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: CTCACTTTCTTGCTCGTCACTCTTTTTGCCCTCGCRight flanking sequence: CAATGTCATGCAAGCACAGCGTTACGATCGAGCCinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GTGCTTGCATGACATTGGCGMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616"
Proper citation: RRID:WB-STRAIN:WBStrain00031058 Copy
http://www.wormbase.org/db/get?name=WBStrain00031127
Source Database: WormBase (WB)
Affected Genes: WBGene00001535(gcy-8)
Genomic Alteration: WBGene00001535(gcy-8)
Availability: available
Source References: PMID:38530893
Synonyms: oyIs18 [gcy-8p::gfp]
Alternate IDs: WB-STRAIN:PY1322, CGC_PY1322
Notes: oyIs18 [gcy-8::GFP]. GFP in AFD.
Proper citation: RRID:WB-STRAIN:WBStrain00031127 Copy
http://www.wormbase.org/db/get?name=WBStrain00031132
Source Database: WormBase (WB)
Affected Genes: WBGene00000553(cmk-1)
Genomic Alteration: WBGene00000553(cmk-1)
Availability: available
Source References: EMPTY
Synonyms: cmk-1(oy21) IV.
Alternate IDs: WB-STRAIN:PY1589, CGC_PY1589
Notes: Thermotaxis defective.
Proper citation: RRID:WB-STRAIN:WBStrain00031132 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
