Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
RB1227 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031927 | Caenorhabditis elegans | Y49E10.20(ok1286) III. | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"Supplementary_genotype [scav-3(ok1286)]"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y49E10.20 Homozygous. Outer Left Sequence: cttcttttcgcgtgctctct. Outer Right Sequence: gacaagactagtccgccagc. Inner Left Sequence: gcgggatttcgtcaaaataa. Inner Right Sequence: tcagcaagattttctcggct. Inner Primer PCR Length: 3106. Estimated Deletion Size: about 1100 bp." | WBGene00013039(scav-3) | WBGene00013039(scav-3) | WB-STRAIN:WBStrain00031927 | WormBase (WB) | WB | available | PMID:37644339 | WB-STRAIN:RB1227, CGC_RB1227 | 2026-08-08 10:14:14 | 1 | ||
|
RB1226 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031926 | Caenorhabditis elegans | acr-18(ok1285) V. | F28F8.1 Homozygous. Outer Left Sequence: tcccacatctctcacccttc. Outer Right Sequence: gcactctccgctcatctctc. Inner Left Sequence: gtgctcttcaccgaatccat. Inner Right Sequence: atgtcaaagaaatccgaccg. Inner Primer PCR Length: 3125. Estimated Deletion Size: about 2400 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000057(acr-18) | WBGene00000057(acr-18) | WB-STRAIN:WBStrain00031926 | WormBase (WB) | WB | available | PMID:38338915 | WB-STRAIN:RB1226, CGC_RB1226 | 2026-08-08 10:14:14 | 1 | ||
|
RB1237 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031937 | Caenorhabditis elegans | B0416.1(ok1302) X. | B0416.1 Homozygous. Outer Left Sequence: gcttcaaaaatagggcctcc. Outer Right Sequence: tttatttggatcagcccagc. Inner Left Sequence: cgtcagcacgcttttaatca. Inner Right Sequence: aggtacaaattggcgacctg. Inner Primer PCR Length: 3349. Estimated Deletion Size: about 1300 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00015177(tmc-2) | WBGene00015177(tmc-2) | WB-STRAIN:WBStrain00031937 | WormBase (WB) | WB | available | WB-STRAIN:RB1237, CGC_RB1237 | 2026-08-08 10:14:14 | 1 | |||
|
RB1289 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031988 | Caenorhabditis elegans | C43C3.2(ok1388) X. | C43C3.2 Homozygous. Outer Left Sequence: catacccaagtacgcgtgaa. Outer Right Sequence: tgaaagtcaactggtggcag. Inner Left Sequence: ccacgtcgcctgttaagttt. Inner Right Sequence: acagttgcagaagcgagaca. Inner Primer PCR Length: 2850. Estimated Deletion Size: about 900 bp. Breakpoint data provided by Neline Kriek 10/2004: AAGTCANCACTGGAATGCATCTGTATAAGTGTGTCGATGATCTTGGTCGCGAGTTGTTT GTTGTATTTACTTTGTACTbreakpointACGACGAACACCCGACCTGAATATAGCGAG CTAATCGCAATACGTAAGTTGTTATCATTCAAGTT.|"C43C3.2 Homozygous. Outer Left Sequence: catacccaagtacgcgtgaa. Outer Right Sequence: tgaaagtcaactggtggcag. Inner Left Sequence: ccacgtcgcctgttaagttt. Inner Right Sequence: acagttgcagaagcgagaca. Inner Primer PCR Length: 2850. Estimated Deletion Size: about 900 bp. Breakpoint data provided by Neline Kriek 10/2004: AAGTCANCACTGGAATGCATCTGTATAAGTGTGTCGATGATCTTGGTCGCGAGTTGTTTGTTGTATTTACTTTGTACTbreakpointACGACGAACACCCGACCTGAATATAGCGAGCTAATCGCAATACGTAAGTTGTTATCATTCAAGTT."|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00008065(npr-18) | WBGene00008065(npr-18) | WB-STRAIN:WBStrain00031988 | WormBase (WB) | WB | available | PMID:38446031 | WB-STRAIN:RB1289, CGC_RB1289 | 2026-08-08 10:14:14 | 2 | ||
|
RB1203 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031904 | Caenorhabditis elegans | T10B11.2(ok1252) I. | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"T10B11.2 Homozygous. Outer Left Sequence: GGTTCGGCAAAGCACATAAT. Outer Right Sequence: TAACAACGGCATTGAATGGA. Inner Left Sequence: TCATTCCGACGGTACCATTT. Inner Right Sequence: TGAAGCTTGAAATGCAGTGG. Inner Primer PCR Length: 2465. Estimated Deletion Size: about 1300 bp."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00020398(cerk-1) | WBGene00020398(cerk-1) | WB-STRAIN:WBStrain00031904 | WormBase (WB) | WB | available | WB-STRAIN:RB1203, CGC_RB1203 | 2026-08-08 10:14:13 | 1 | |||
|
RB1209 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031910 | Caenorhabditis elegans | brc-1(ok1261) III. | C36A4.8 Homozygous. Outer Left Sequence: aagccaatgaactggtggtc. Outer Right Sequence: tttgtgtgcaaacaccgatt. Inner Left Sequence: gttgagaccgcagaaatcgt. Inner Right Sequence: caaaccgacacaaaatcacg. Inner Primer PCR Length: 2392. Estimated Deletion Size: about 1600 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000264(brc-1) | WBGene00000264(brc-1) | WB-STRAIN:WBStrain00031910 | WormBase (WB) | WB | available | WB-STRAIN:RB1209, CGC_RB1209 | 2026-08-08 10:14:13 | 1 | |||
|
RB1297 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031996 | Caenorhabditis elegans | rhy-1(ok1402) II. | Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"W07A12.7 Homozygous. Outer Left Sequence: cgtcagcatacccagtgttg. Outer Right Sequence: tcaatggcattagcaactcg. Inner Left Sequence: ctccccgttacattttgcat. Inner Right Sequence: tgggtggcaaaagaaaacat. Inner Primer PCR Length: 2148. Estimated Deletion Size: about 700 bp." | WBGene00012324(rhy-1) | WBGene00012324(rhy-1) | WB-STRAIN:WBStrain00031996 | WormBase (WB) | WB | available | WB-STRAIN:RB1297, CGC_RB1297 | 2026-08-08 10:14:14 | 1 | |||
|
RB1279 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031979 | Caenorhabditis elegans | rfs-1(ok1372) III. | C30A5.2 Homozygous. Outer Left Sequence: cttccaaatcagcagcaaca. Outer Right Sequence: tctggttgtcgaatgagcag. Inner Left Sequence: ttgcacaaatcgctaatcca. Inner Right Sequence: tgggagtcttgtagtgggct. Inner Primer PCR Length: 2227. Estimated Deletion Size: about 1200 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"Supplementary_genotype rfs-1(ok1372)"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00004342(rfs-1) | WBGene00004342(rfs-1) | WB-STRAIN:WBStrain00031979 | WormBase (WB) | WB | available | PMID:36176234 | WB-STRAIN:RB1279, CGC_RB1279 | 2026-08-08 10:14:14 | 1 | ||
|
RB1250 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031950 | Caenorhabditis elegans | acr-21(ok1314) III. | F27B3.2 Homozygous. Outer Left Sequence: caaaagagggtgtcgggtaa. Outer Right Sequence: aaacaccacaagcaggaagc. Inner Left Sequence: aaactgcagacggagctcat. Inner Right Sequence: tgaaattttgggaggattcg. Inner Primer PCR Length: 2667. Estimated Deletion Size: about 1300 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000060(acr-21) | WBGene00000060(acr-21) | WB-STRAIN:WBStrain00031950 | WormBase (WB) | WB | available | PMID:38338915 | WB-STRAIN:RB1250, CGC_RB1250 | 2026-08-08 10:14:14 | 1 | ||
|
RB1369 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032068 | Caenorhabditis elegans | F14D12.5(ok1554) X. | F14D12.5 Homozygous. Outer Left Sequence: tttagttacgcgggtatggg. Outer Right Sequence: tgaaaaagttggcaatgcac. Inner Left Sequence: tcttttctggcggcatactt. Inner Right Sequence: ggacttacgatgggcgttta. Inner Primer PCR Length: 2705. Estimated Deletion Size: about 1600 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00017464(sulp-2) | WBGene00017464(sulp-2) | WB-STRAIN:WBStrain00032068 | WormBase (WB) | WB | available | WB-STRAIN:RB1369, CGC_RB1369 | 2026-08-08 10:14:15 | 1 | |||
|
RB1367 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032066 | Caenorhabditis elegans | Y73E7A.4(ok1552) I. | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y73E7A.4 Homozygous. Outer Left Sequence: ctcaatagagcgcgatttcc. Outer Right Sequence: gaggggcacggttaattttt. Inner Left Sequence: tcgccatagttttcgctttt. Inner Right Sequence: tttttgatgggtgggaatgt. Inner Primer PCR Length: 2695. Estimated Deletion Size: about 1200 bp." | WBGene00022271(cpx-1) | WBGene00022271(cpx-1) | WB-STRAIN:WBStrain00032066 | WormBase (WB) | WB | available | PMID:38362034 | WB-STRAIN:RB1367, CGC_RB1367 | 2026-08-08 10:14:15 | 2 | ||
|
RB1366 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032065 | Caenorhabditis elegans | F14D12.5(ok1551) X. | F14D12.5 Homozygous. Outer Left Sequence: tttagttacgcgggtatggg. Outer Right Sequence: tgaaaaagttggcaatgcac. Inner Left Sequence: tcttttctggcggcatactt. Inner Right Sequence: ggacttacgatgggcgttta. Inner Primer PCR Length: 2705. Estimated Deletion Size: about 600 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00017464(sulp-2) | WBGene00017464(sulp-2) | WB-STRAIN:WBStrain00032065 | WormBase (WB) | WB | available | WB-STRAIN:RB1366, CGC_RB1366 | 2026-08-08 10:14:15 | 1 | |||
|
RB1365 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032064 | Caenorhabditis elegans | npr-16(ok1541) X. | F56B6.5 Homozygous. Outer Left Sequence: acaaatcgcaattttccagc. Outer Right Sequence: acaagtccgcaaggtcacat. Inner Left Sequence: caagggtcttcacaatcggt. Inner Right Sequence: tttgatttctcatcgggagg. Inner Primer PCR Length: 3344. Estimated Deletion Size: about 1450 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00006864(npr-16) | WBGene00006864(npr-16) | WB-STRAIN:WBStrain00032064 | WormBase (WB) | WB | available | PMID:38302462 PMID:38446031 |
WB-STRAIN:RB1365, CGC_RB1365 | 2026-08-08 10:14:15 | 4 | ||
|
RB1332 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032031 | Caenorhabditis elegans | trx-1(ok1449) II. | B0228.5 Homozygous. Outer Left Sequence: cgccgtggttaacctcttta. Outer Right Sequence: ttatcggacaataggcggac. Inner Left Sequence: ctgttgactcccaacaccct. Inner Right Sequence: ttgcaaaagaaattttcgcc. Inner Primer PCR Length: 2357. Estimated Deletion Size: about 850 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00015062(trx-1) | WBGene00015062(trx-1) | WB-STRAIN:WBStrain00032031 | WormBase (WB) | WB | available | PMID:38446031 | WB-STRAIN:RB1332, CGC_RB1332 | 2026-08-08 10:14:15 | 2 | ||
|
RB1340 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032039 | Caenorhabditis elegans | nlp-1(ok1469) X. | C01C4.1 Homozygous. Outer Left Sequence: gaaacattgtgctccaccct. Outer Right Sequence: attcagaagcggaaagagca. Inner Left Sequence: gtgcgtacccagagcatttt. Inner Right Sequence: caattgtgtcctccccctaa. Inner Primer PCR Length: 2212. Estimated Deletion Size: about 700 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00003739(nlp-1) | WBGene00003739(nlp-1) | WB-STRAIN:WBStrain00032039 | WormBase (WB) | WB | available | WB-STRAIN:RB1340, CGC_RB1340 | 2026-08-08 10:14:15 | 1 | |||
|
RB1341 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032040 | Caenorhabditis elegans | nlp-1(ok1470) X. | C01C4.1 Homozygous. Outer Left Sequence: gaaacattgtgctccaccct. Outer Right Sequence: attcagaagcggaaagagca. Inner Left Sequence: gtgcgtacccagagcatttt. Inner Right Sequence: caattgtgtcctccccctaa. Inner Primer PCR Length: 2212. Estimated Deletion Size: about 600 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain mapped, WBPaper00059878 added based on AFP_Strain data." | WBGene00003739(nlp-1) | WBGene00003739(nlp-1) | WB-STRAIN:WBStrain00032040 | WormBase (WB) | WB | available | PMID:32576621 PMID:38573858 |
WB-STRAIN:RB1341, CGC_RB1341 | 2026-08-08 10:14:15 | 1 | ||
|
RB1342 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032041 | Caenorhabditis elegans | ogt-1h | K04G7.3 Homozygous. Outer Left Sequence: gccaaagaattgatttcgga. Outer Right Sequence: tgctcttgcaccacaaccta. Inner Left Sequence: acctgtccgagaccattctg. Inner Right Sequence: ccaacgctattgctcctctc. Inner Primer PCR Length: 2730. Estimated Deletion Size: about 1300 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain mapped, WBPaper00059970 added based on AFP_Strain data." | WBGene00003858(ogt-1) | WBGene00003858(ogt-1) | WB-STRAIN:WBStrain00032041 | WormBase (WB) | WB | available | PMID:32628333 PMID:37991448 PMID:38488606 |
WB-STRAIN:RB1342, CGC_RB1342 | 2026-08-08 10:14:15 | 2 | ||
|
RB1401 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032099 | Caenorhabditis elegans | T19B10.6(ok260) V. | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"T19B10.6. Unc."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00011834(dvc-1) | WBGene00011834(dvc-1) | WB-STRAIN:WBStrain00032099 | WormBase (WB) | WB | available | PMID:31839537 | WB-STRAIN:RB1401, CGC_RB1401 | 2026-08-08 10:14:16 | 1 | ||
|
RB1311 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032010 | Caenorhabditis elegans | R05D11.8(ok1427) I. | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"R05D11.8 Homozygous. Outer Left Sequence: gctgcgtgaacatcaagaaa. Outer Right Sequence: attccaacgacttgccaaag. Inner Left Sequence: tttgaccatggcgaatgtta. Inner Right Sequence: tagagggatcgctggagaaa. Inner Primer PCR Length: 2546. Estimated Deletion Size: about 800 bp."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00011036(edc-3) | WBGene00011036(edc-3) | WB-STRAIN:WBStrain00032010 | WormBase (WB) | WB | available | WB-STRAIN:RB1311, CGC_RB1311 | 2026-08-08 10:14:15 | 1 | |||
|
RB1325 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00032024 | Caenorhabditis elegans | C53C7.1(ok1442) X. | C53C7.1 Homozygous. Outer Left Sequence: ggatcgtcttgtggtgcttt. Outer Right Sequence: ggggcctcttaacctttttg. Inner Left Sequence: ctggattgccctgaaattgt. Inner Right Sequence: gcagacaaagcatgacctga. Inner Primer PCR Length: 3020. 11/18/04: From Neline Kriek: This has a 788 bp deletion with a 13 bp insertion (TTCTTTTTTTTGA). The sequence across the breakpoint is: actacgacgtggtgtctttTTCTTTTTTTTGAtgacgtgagtttt.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00008278(npr-10) | WBGene00008278(npr-10) | WB-STRAIN:WBStrain00032024 | WormBase (WB) | WB | available | PMID:38446031 | WB-STRAIN:RB1325, CGC_RB1325 | 2026-08-08 10:14:15 | 2 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.