Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00033160
Source Database: WormBase (WB)
Affected Genes: WBGene00021183(Y9C9A.16)
Genomic Alteration: WBGene00021183(Y9C9A.16)
Availability: available
Source References: EMPTY
Synonyms: Y9C9A.16(ok3440) IV.
Alternate IDs: WB-STRAIN:RB2485, CGC_RB2485
Notes: Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y9C9A.16 Homozygous. Outer Left Sequence: gtcgacagttttcaagtgcg. Outer Right Sequence: ctcgaaaacttccaagtggc. Inner Left Sequence: tgatgcagctgtttttgcat. Inner Right Sequence: tgtcggtggaggtctaatga. Inner Primer PCR Length: 1187. Deletion size: about 400 bp."
Proper citation: RRID:WB-STRAIN:WBStrain00033160 Copy
http://www.wormbase.org/db/get?name=WBStrain00033139
Source Database: WormBase (WB)
Affected Genes: WBGene00006525(tax-2)
Genomic Alteration: WBGene00006525(tax-2)
Availability: available
Source References: PMID:38302462
Synonyms: tax-2(ok3403) I.
Alternate IDs: WB-STRAIN:RB2464, CGC_RB2464
Notes: F36F2.5 Homozygous. Outer Left Sequence: cgccaagaagtgaagattcc. Outer Right Sequence: acgcttgtaatgccgaaagt. Inner Left Sequence: gcaaatgcttcaaaagagcc. Inner Right Sequence: gagtccgagcaattctgaaaa. Inner Primer PCR Length: 1121. Deletion size: about 400 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00033139 Copy
http://www.wormbase.org/db/get?name=WBStrain00033105
Source Database: WormBase (WB)
Affected Genes: WBGene00006570(tig-2)
Genomic Alteration: WBGene00006570(tig-2)
Availability: available
Source References: EMPTY
Synonyms: tig-2(ok3336) V.
Alternate IDs: WB-STRAIN:RB2430, CGC_RB2430
Notes: F39G3.8 Homozygous. Outer Left Sequence: gagttgtggaggcggatcta. Outer Right Sequence: agtgtttccagacaggccac. Inner Left Sequence: tcagagctttagcggcaaat. Inner Right Sequence: aacaaatccgcgagctctt. Inner Primer PCR Length: 1207. Deletion size: about 500 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00033105 Copy
http://www.wormbase.org/db/get?name=WBStrain00033196
Source Database: WormBase (WB)
Affected Genes: WBGene00013486(egas-1)
Genomic Alteration: WBGene00013486(egas-1)
Availability: available
Source References: PMID:37500635
Synonyms: Y69H2.11(ok3497) V.
Alternate IDs: WB-STRAIN:RB2521, CGC_RB2521
Notes: Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y69H2.11 Homozygous. Outer Left Sequence: tttaggattttcgtggtggg. Outer Right Sequence: catgcgaagtcagtggagaa. Inner Left Sequence: tttggattcatgattggcct. Inner Right Sequence: ctgacaccacgtgccttcta. Inner Primer PCR Length: 1182. Estimated Deletion Size: about 500 bp."
Proper citation: RRID:WB-STRAIN:WBStrain00033196 Copy
http://www.wormbase.org/db/get?name=WBStrain00033278
Source Database: WormBase (WB)
Affected Genes: WBGene00001500(ftn-1)
Genomic Alteration: WBGene00001500(ftn-1)
Availability: available
Source References: PMID:32302543
Synonyms: ftn-1(ok3625) V.
Alternate IDs: WB-STRAIN:RB2603, CGC_RB2603
Notes: C54F6.14 Homozygous. Outer Left Sequence: atgtgtctcagatttccgcc. Outer Right Sequence: gaaccctttcgttgccaata. Inner Left Sequence: ggttgaacctttttaggaactgc. Inner Right Sequence: acagtcccggacacgtaatc. Inner Primer PCR Length: 1178. Estimated Deletion Size: about 500 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain mapped, WBPaper00059578 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00033278 Copy
http://www.wormbase.org/db/get?name=WBStrain00033256
Source Database: WormBase (WB)
Affected Genes: WBGene00013241(ung-1)
Genomic Alteration: WBGene00013241(ung-1)
Availability: available
Source References: PMID:39149885
Synonyms: Y56A3A.29(ok3593) III.
Alternate IDs: WB-STRAIN:RB2581, CGC_RB2581
Notes: Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y56A3A.29 Homozygous. Outer Left Sequence: aatcgtctctggctctctgg. Outer Right Sequence: cggtttgcctgcaaataact. Inner Left Sequence: gagcaaacccctgaattttt. Inner Right Sequence: cgaataatttcccatttttgtga. Inner Primer PCR Length: 1166. Estimated Deletion Size: about 500 bp."
Proper citation: RRID:WB-STRAIN:WBStrain00033256 Copy
http://www.wormbase.org/db/get?name=WBStrain00033286
Source Database: WormBase (WB)
Affected Genes: WBGene00002011(hsp-12.2)
Genomic Alteration: WBGene00002011(hsp-12.2)
Availability: available
Source References: PMID:38987256
Synonyms: hsp-12.2(ok3638) III.
Alternate IDs: WB-STRAIN:RB2612, CGC_RB2612
Notes: C14B9.1 Homozygous. Outer Left Sequence: tttcaggtccacaacaccaa. Outer Right Sequence: aaaatcatccctcgatgtgc. Inner Left Sequence: agttcgaggtcggacttgac. Inner Right Sequence: cattattcgtgcgttgatgc. Inner Primer PCR Length: 1096. Estimated Deletion Size: about 400 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00033286 Copy
http://www.wormbase.org/db/get?name=WBStrain00033289
Source Database: WormBase (WB)
Affected Genes: WBGene00006365(syg-1)
Genomic Alteration: WBGene00006365(syg-1)
Availability: available
Source References: EMPTY
Synonyms: syg-1(ok3640) X.
Alternate IDs: WB-STRAIN:RB2615, CGC_RB2615
Notes: K02E10.8 Homozygous. Outer Left Sequence: gcatcacatggaagccctat. Outer Right Sequence: tcccgaagatgaccacaaat. Inner Left Sequence: tccgcaagtttccagaaaag. Inner Right Sequence: atacgcgccacaaatcaact. Inner Primer PCR Length: 1249. Estimated Deletion Size: about 500 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00033289 Copy
http://www.wormbase.org/db/get?name=WBStrain00033219
Source Database: WormBase (WB)
Affected Genes: WBGene00002087(ins-4)
Genomic Alteration: WBGene00002087(ins-4)
Availability: available
Source References: PMID:34634043
Synonyms: ins-4(ok3534)
Alternate IDs: WB-STRAIN:RB2544, CGC_RB2544
Notes: Made_by: OMRF Knockout Group|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK75.1 Homozygous. Outer Left Sequence: ccggtaccgacttggaacta. Outer Right Sequence: agaaagctgggtcgtgagac. Inner Left Sequence: caaaagcgttcactctagaaaat. Inner Right Sequence: aaaaagacaaccgtccctcc. Inner Primer PCR Length: 1111. Estimated Deletion Size: about 400 bp."
Proper citation: RRID:WB-STRAIN:WBStrain00033219 Copy
http://www.wormbase.org/db/get?name=WBStrain00033309
Source Database: WormBase (WB)
Availability: available
Source References: PMID:9136008, PMID:9741632, PMID:18801967, PMID:18993077, PMID:31704915, PMID:33820969, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:RC301, CGC_RC301
Notes: Reference WBG 9(3) 29 and 10(2) 140-141. npr-1 pka bor-1. Caenorhabditis elegans wild isolate (Tc1 pattern HCF).|"Reference WBPaper00058832 added based on published strain data identified by Textpresso literature search."
Proper citation: RRID:WB-STRAIN:WBStrain00033309 Copy
http://www.wormbase.org/db/get?name=WBStrain00033316
Source Database: WormBase (WB)
Affected Genes: WBGene00002147(ire-1)
Genomic Alteration: WBGene00002147(ire-1)
Availability: available
Source References: PMID:33542359, PMID:36924492, PMID:39436952
Synonyms: ire-1(v33) II.
Alternate IDs: WB-STRAIN:RE666, CGC_RE666
Notes: Made_by: X. Shen|"Slow growth. Abnormal tail."|"Supplementary_genotype ire-1(v33) II"
Proper citation: RRID:WB-STRAIN:WBStrain00033316 Copy
http://www.wormbase.org/db/get?name=WBStrain00033395
Source Database: WormBase (WB)
Affected Genes: WBGene00004910(snf-11)
Genomic Alteration: WBGene00004910(snf-11)
Availability: available
Source References: PMID:31415799
Synonyms: snf-11(ok156) V.
Alternate IDs: WB-STRAIN:RM2710, CGC_RM2710
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"No obvious phenotype."|"Superficially wild-type growth and behavior. unc-25-dependent aldicarb resistance. unc-25-dependent phenotypes are not rescued by exogenous GABA. Molecular details: 1491-bp deletion, removes exon 3, exon 4, and most of exon 5. Flanking sequences: AAAACTTCCACCAAGCACTT/ /AATTATATAACTATGTCACA Reference: Mullen GP, et al. Mol Biol Cell. 2006 Jul;17(7):3021-30."
Proper citation: RRID:WB-STRAIN:WBStrain00033395 Copy
http://www.wormbase.org/db/get?name=WBStrain00033400
Source Database: WormBase (WB)
Affected Genes: WBGene00001032(dnj-14)
Genomic Alteration: WBGene00001032(dnj-14)
Availability: available
Source References: EMPTY
Synonyms: dnj-14(ok237) X.
Alternate IDs: WB-STRAIN:RM2754, CGC_RM2754
Notes: Knock-out allele ok237 is a large (2229-bp) deletion. Coordinates: leftmost deleted base = 35441 of K02G10; rightmost deleted base = 296 of F55D10. ok237 eliminates almost all of K02G10.8 (dnj-14) and also the 5'-part of F55D10.3 (glit-1, encodes a homolog of gliotactin), as well as the presumed promoter regions between the 2 genes. In addition, F55D10.3 could be the first member of an operon, with F55D10.2 (aka rpl25.1, which encodes a ribosomal protein) as the second member of the operon. The deletion is likely to eliminate the expression of 2 or 3 genes, not just dnj-14.|"Made_by: OMRF Knockout Group"
Proper citation: RRID:WB-STRAIN:WBStrain00033400 Copy
http://www.wormbase.org/db/get?name=WBStrain00033326
Source Database: WormBase (WB)
Affected Genes: WBGene00000100(ajm-1)
Genomic Alteration: WBGene00000100(ajm-1)
Availability: available
Source References: PMID:31307392
Synonyms: wIs78 IV.
Alternate IDs: WB-STRAIN:RG733, CGC_RG733
Notes: wIs78 [SCMp::GFP + ajm-1p::GFP + F58E10 (cosmid) + unc-119(+)] IV. GFP expression in seam cells and adherens junctions. Check periodically for GFP in seam cells to retain robust expression. ajm-1 previously called jam-1. Derived by outcrossing JR1000. It is not know whether the ced-1(e1735) or unc-119(ed4) mutations are still present, as the array rescues both phenotypes. wIs78 males do not mate very well; heterozygotes mate fine.|"wIs78 [SCMp::GFP + ajm-1p::GFP + F58E10 (cosmid) + unc-119(+)]. GFP expression in seam cells and adherens junctions. ajm-1 previously called jam-1. Derived by outcrossing JR1000. It is not know whether the ced-1(e1735) or unc-119(ed4) mutations are still present, as the array rescues both phenotypes. wIs78 males do not mate very well; heterozygotes mate fine."|"wIs78 [SCMp::GFP + ajm-1p::GFP + F58E10 (cosmid) + unc-119(+)]. GFP expression in seam cells and adherens junctions. Check periodically for GFP in seam cells to retain robust expression. ajm-1 previously called jam-1. Derived by outcrossing JR1000. It is not know whether the ced-1(e1735) or unc-119(ed4) mutations are still present, as the array rescues both phenotypes. wIs78 males do not mate very well; heterozygotes mate fine."
Proper citation: RRID:WB-STRAIN:WBStrain00033326 Copy
http://www.wormbase.org/db/get?name=WBStrain00033439
Source Database: WormBase (WB)
Affected Genes: WBGene00003225(mev-1)
Genomic Alteration: WBGene00003225(mev-1)
Availability: unknown
Source References: PMID:26108372
Synonyms: mev-1(tr393) III.
Alternate IDs: WB-STRAIN:RP2674
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00033439 Copy
http://www.wormbase.org/db/get?name=WBStrain00033482
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: PMID:39097626
Synonyms: unc-119(ed3) III; pwIs503.
Alternate IDs: WB-STRAIN:RT1315, CGC_RT1315
Notes: pwIs503 [vha-6p::mans::GFP + Cbr-unc-119(+)]. This strain expresses an intestine-specific GFP marker for the Golgi apparatus (a fragment of C. elegans alpha-mannosidase II (F58H1.1, first 82 aa including signal sequence/TM-anchor domain as in Rolls et al., 2002). This fusion protein is expressed under the control of the vha-6 promoter.
Proper citation: RRID:WB-STRAIN:WBStrain00033482 Copy
http://www.wormbase.org/db/get?name=WBStrain00033470
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: PMID:32918875, PMID:37957360, PMID:39264947, PMID:39299237, PMID:39418305
Synonyms: unc-119(ed3) III; pwIs50.
Alternate IDs: WB-STRAIN:RT258, CGC_RT258
Notes: pwIs50 [lmp-1::GFP + Cbr-unc-119(+)].|"Supplementary_genotype unc-119(ed3) III;pwIs50[lmp-1::GFP + Cbr-unc-119(+)]"
Proper citation: RRID:WB-STRAIN:WBStrain00033470 Copy
http://www.wormbase.org/db/get?name=WBStrain00033479
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; pwIs206.
Alternate IDs: WB-STRAIN:RT525, CGC_RT525
Notes: pwIs206 [vha6p::GFP::rab-10 + Cbr-unc-119(+)].
Proper citation: RRID:WB-STRAIN:WBStrain00033479 Copy
http://www.wormbase.org/db/get?name=WBStrain00033476
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: PMID:32918875, PMID:39097626
Synonyms: unc-119(ed3) III; pwIs170.
Alternate IDs: WB-STRAIN:RT476, CGC_RT476
Notes: pwIs170 [vha6p::GFP::rab-7 + Cbr-unc-119(+)].
Proper citation: RRID:WB-STRAIN:WBStrain00033476 Copy
http://www.wormbase.org/db/get?name=WBStrain00033447
Source Database: WormBase (WB)
Affected Genes: WBGene00003225(mev-1)
Genomic Alteration: WBGene00003225(mev-1)
Availability: available
Source References: PMID:26108372
Synonyms: mev-1(tr407) III.
Alternate IDs: WB-STRAIN:RP2698, CGC_RP2698
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00033447 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
