Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Availability:unknown (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

122,863 Results - per page

Show More Columns | Download Top 1000 Results

Organism Name Proper Citation Species Synonyms Notes Phenotype Affected Gene Genomic Alteration Catalog Number Background Database Database Abbreviation Availability Source References Alternate IDs Record Last Update Mentions Count
RW11383
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033694 Caenorhabditis elegans unc-119(ed3) III; stIs11383. Made_by: E Preston/J Murray|"stIs11383 [Y71G12B.6::H1-wCherry + unc-119(+)]." WBGene00006843(unc-119) WBGene00006843(unc-119) WB-STRAIN:WBStrain00033694 WormBase (WB) WB unknown WB-STRAIN:RW11383 2026-08-08 10:14:37 0
RZB213
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033875 Caenorhabditis elegans plst-1(msn190[plst-1::gfp]) IV. Reference WBPaper00056840 added based on published strain data identified by Textpresso literature search. WBGene00022425(plst-1) WBGene00022425(plst-1) WB-STRAIN:WBStrain00033875 WormBase (WB) WB unknown PMID:28400443
PMID:31160462
WB-STRAIN:RZB213 2026-08-08 10:14:39 0
RZB217
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00033876 Caenorhabditis elegans plst-1(msn190[plst-1::gfp]) IV; zbIs2(pie-1::lifeACT::RFP). EMPTY WBGene00022425(plst-1) WBGene00022425(plst-1) WB-STRAIN:WBStrain00033876 WormBase (WB) WB unknown PMID:28400443 WB-STRAIN:RZB217 2026-08-08 10:14:39 3
SD1145
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033920 Caenorhabditis elegans EMPTY EMPTY WBGene00001790(gst-42) WBGene00001790(gst-42) WB-STRAIN:WBStrain00033920 WormBase (WB) WB unknown WB-STRAIN:SD1145 2026-08-08 10:14:40 0
SD1147
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033922 Caenorhabditis elegans EMPTY EMPTY WBGene00016097(C25E10.8) WBGene00016097(C25E10.8) WB-STRAIN:WBStrain00033922 WormBase (WB) WB unknown WB-STRAIN:SD1147 2026-08-08 10:14:40 0
SD1158
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033925 Caenorhabditis elegans EMPTY EMPTY WBGene00000412(cdr-1) WBGene00000412(cdr-1) WB-STRAIN:WBStrain00033925 WormBase (WB) WB unknown WB-STRAIN:SD1158 2026-08-08 10:14:40 0
SD1168
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033928 Caenorhabditis elegans EMPTY EMPTY WBGene00000615(col-38) WBGene00000615(col-38) WB-STRAIN:WBStrain00033928 WormBase (WB) WB unknown WB-STRAIN:SD1168 2026-08-08 10:14:40 0
SD1172
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033931 Caenorhabditis elegans pha-1(e2123) III; mvEx5506. mvEx5506 [mtl-1p::GFP + pha-1(+)]. Maintain at 25C to select for presence of the array. WBGene00003473(mtl-1)|WBGene00004010(pha-1) WBGene00003473(mtl-1), WBGene00004010(pha-1) WB-STRAIN:WBStrain00033931 WormBase (WB) WB unknown WB-STRAIN:SD1172 2026-08-08 10:14:40 0
SD1175
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033934 Caenorhabditis elegans EMPTY EMPTY WBGene00001789(gst-41) WBGene00001789(gst-41) WB-STRAIN:WBStrain00033934 WormBase (WB) WB unknown WB-STRAIN:SD1175 2026-08-08 10:14:40 0
SD1176
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033935 Caenorhabditis elegans EMPTY EMPTY WBGene00006207(str-162) WBGene00006207(str-162) WB-STRAIN:WBStrain00033935 WormBase (WB) WB unknown WB-STRAIN:SD1176 2026-08-08 10:14:40 0
SD1139
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00033918 Caenorhabditis elegans EMPTY EMPTY WBGene00011244(R11D1.3) WBGene00011244(R11D1.3) WB-STRAIN:WBStrain00033918 WormBase (WB) WB unknown WB-STRAIN:SD1139 2026-08-08 10:14:40 0
SD1823
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00034024 Caenorhabditis elegans unc-119(ed3) III; gaEx232. gaEx207 [sod-3p::mCherry + aakg-2(sta2) + unc-119(+)]. Reference: Sagi D & Kim SK. PLoS Genet. 2012 Jun;8(6):e1002780.|"gaEx232 [aakg-2(sta2)(+) + sod-3p::mCherry + unc-119(+)]. Pick mCherry+ non-Unc to maintain. Long-lived. Over-expression of activated AAKG-2. Reference: Sagi D and Kim SK. PLoS Genet. 2012;8(6):e1002780." WBGene00006843(unc-119) WBGene00006843(unc-119) WB-STRAIN:WBStrain00034024 WormBase (WB) WB unknown WB-STRAIN:SD1823 2026-08-08 10:14:41 0
SM1535
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00034114 Caenorhabditis elegans EMPTY EMPTY WBGene00003976(pes-1) WBGene00003976(pes-1) WB-STRAIN:WBStrain00034114 WormBase (WB) WB unknown WB-STRAIN:SM1535 2026-08-08 10:14:43 0
SOZ471
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00034121 Caenorhabditis elegans sams-1(ssd206) X. no longer available from the CGC|"sams-1 (a.k.a.- drop-4) Class IV supersized lipid droplet mutant. GCT-->GTT mutation. 5' flanking sequence: agatccaaatgcaaaggttg. 3' flanking sequence: ttgcgagaccgtaacaaaaa References: Li S, et al. G3 (Bethesda). 2016 Aug 9;6(8):2407-19. Li S, et al. Proc Natl Acad Sci U S A. 2017 Aug 15;114(33):8841-8846." WBGene00008205(sams-1) WBGene00008205(sams-1) WB-STRAIN:WBStrain00034121 WormBase (WB) WB unknown WB-STRAIN:SOZ471 2026-08-08 10:14:43 0
SM202
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00034105 Caenorhabditis elegans EMPTY EMPTY WBGene00003937(pax-1) WBGene00003937(pax-1) WB-STRAIN:WBStrain00034105 WormBase (WB) WB unknown WB-STRAIN:SM202 2026-08-08 10:14:42 0
SP978
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00034341 Caenorhabditis elegans EMPTY EMPTY WB-STRAIN:WBStrain00034341 WormBase (WB) WB unknown WB-STRAIN:SP978 2026-08-08 10:14:46 0
ST205
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00034492 Caenorhabditis elegans EMPTY EMPTY WB-STRAIN:WBStrain00034492 WormBase (WB) WB unknown WB-STRAIN:ST205 2026-08-08 10:14:48 0
SS629
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00034450 Caenorhabditis elegans EMPTY EMPTY WBGene00004027(pie-1) WBGene00004027(pie-1) WB-STRAIN:WBStrain00034450 WormBase (WB) WB unknown WB-STRAIN:SS629 2026-08-08 10:14:48 0
STR59
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00034513 Caenorhabditis elegans cdk-5(ok626);hrtSi4[Pgcy-36::ebp-2::gfp] EMPTY WB-STRAIN:WBStrain00034513 WormBase (WB) WB unknown PMID:30254025 WB-STRAIN:STR59 2026-08-08 10:14:49 0
STR83
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00034517 Caenorhabditis elegans iaIs22[Pgcy-36::gfp];hrtEx21[Pgcy-36::tbg-1::mKate2] EMPTY WB-STRAIN:WBStrain00034517 WormBase (WB) WB unknown PMID:30254025 WB-STRAIN:STR83 2026-08-08 10:14:49 0

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.