Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00034476
Source Database: WormBase (WB)
Affected Genes: WBGene00003497(mup-4)|WBGene00004857(sma-3)|WBGene00006768(unc-32)
Genomic Alteration: WBGene00003497(mup-4), WBGene00004857(sma-3), WBGene00006768(unc-32)
Availability: available
Source References: EMPTY
Synonyms: ncIs2 II; mup-4(nc20)/sma-3(e491) unc-32(e189) III.
Alternate IDs: WB-STRAIN:ST20, CGC_ST20
Notes: Made_by: Go Shioi|"ncIs2 [pH20::GFP + pBlueScript]. Heterozygotes are WT and segregate WT, SmaUnc, and animals with muscle attachment defects and ventral cord displacement and detachment which arrest in larval development or as embryos. Not well balanced. Neurons visualized with NcIs2."
Proper citation: RRID:WB-STRAIN:WBStrain00034476 Copy
http://www.wormbase.org/db/get?name=WBStrain00034481
Source Database: WormBase (WB)
Affected Genes: WBGene00008263(ven-1)
Genomic Alteration: WBGene00008263(ven-1)
Availability: available
Source References: EMPTY
Synonyms: ven-1(nc28) LGV
Alternate IDs: WB-STRAIN:ST28, CGC_ST28
Notes: Made_by: Go Shioi|"Ventral cord displacement and detachment. Muscle attachment defects. Some larval lethality."
Proper citation: RRID:WB-STRAIN:WBStrain00034481 Copy
http://www.wormbase.org/db/get?name=WBStrain00034403
Source Database: WormBase (WB)
Affected Genes: WBGene00006366(sym-1)
Genomic Alteration: WBGene00006366(sym-1)
Availability: available
Source References: PMID:38177158
Synonyms: sym-1(mn601) X.
Alternate IDs: WB-STRAIN:SP2163, CGC_SP2163
Notes: Made_by:
Proper citation: RRID:WB-STRAIN:WBStrain00034403 Copy
http://www.wormbase.org/db/get?name=WBStrain00034405
Source Database: WormBase (WB)
Affected Genes: WBGene00006368(sym-3)
Genomic Alteration: WBGene00006368(sym-3)
Availability: available
Source References: EMPTY
Synonyms: sym-3(mn618) X.
Alternate IDs: WB-STRAIN:SP2231, CGC_SP2231
Notes: Made_by: R.K. Herman|"Wild type. Synthetically lethal with mec-8."
Proper citation: RRID:WB-STRAIN:WBStrain00034405 Copy
http://www.wormbase.org/db/get?name=WBStrain00034408
Source Database: WormBase (WB)
Affected Genes: WBGene00004895(smu-1)
Genomic Alteration: WBGene00004895(smu-1)
Availability: available
Source References: EMPTY
Synonyms: smu-1(mn415) I; mnIs35.
Alternate IDs: WB-STRAIN:SP2533, CGC_SP2533
Notes: Made_by: A Spartz & R Herman|"mnIs35 [smu-2::GFP + unc-36(+)]. Superficially wild-type. Although unlikely, unc-36 might still be present in the background. Reference: Spartz AK, et al. Mol Cell Biol. 2004 Aug;24(15):6811-23."
Proper citation: RRID:WB-STRAIN:WBStrain00034408 Copy
http://www.wormbase.org/db/get?name=WBStrain00034483
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00006788(unc-53)|WBGene00006893(spon-1)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00006788(unc-53), WBGene00006893(spon-1)
Availability: available
Source References: EMPTY
Synonyms: spon-1(nc30) ncIs2/dpy-10(e128) unc-53(n569) II.
Alternate IDs: WB-STRAIN:ST30, CGC_ST30
Notes: Made_by: Go Shioi|"ncIs2 [pH20::GFP + pBlueScript]. Heterozygotes are WT and segregate WT, DpyUnc, and animals with muscle attachment defects and ventral cord displacement and detachment which arrest in larval development. Not well balanced. Neurons visualized with ncIs2."
Proper citation: RRID:WB-STRAIN:WBStrain00034483 Copy
http://www.wormbase.org/db/get?name=WBStrain00034484
Source Database: WormBase (WB)
Affected Genes: WBGene00001076(dpy-17)|WBGene00003497(mup-4)|WBGene00006768(unc-32)
Genomic Alteration: WBGene00001076(dpy-17), WBGene00003497(mup-4), WBGene00006768(unc-32)
Availability: available
Source References: EMPTY
Synonyms: ncIs2 II; mup-4(nc35)/dpy-17(e164) unc-32(e189) III.
Alternate IDs: WB-STRAIN:ST35, CGC_ST35
Notes: Made_by: Go Shioi|"ncIs2 [pH20::GFP + pBlueScript]. Heterozygotes are WT and segregate WT, DpyUncs, and animals with muscle attachment defects and ventral cord displacement and detachment which arrest as embyros or in larval development. Not well balanced. Neurons visualized with ncIs2."
Proper citation: RRID:WB-STRAIN:WBStrain00034484 Copy
http://www.wormbase.org/db/get?name=WBStrain00034485
Source Database: WormBase (WB)
Affected Genes: WBGene00004047(plx-1)
Genomic Alteration: WBGene00004047(plx-1)
Availability: available
Source References: EMPTY
Synonyms: plx-1(nc36) IV.
Alternate IDs: WB-STRAIN:ST36, CGC_ST36
Notes: Made_by: Takashi Fujii|"Various epidermal defects. In male tails, ray 1 is dislocated anteriorly."
Proper citation: RRID:WB-STRAIN:WBStrain00034485 Copy
http://www.wormbase.org/db/get?name=WBStrain00034487
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00004047(plx-1)
Genomic Alteration: WBGene00001864(him-5), WBGene00004047(plx-1)
Availability: available
Source References: EMPTY
Synonyms: plx-1(nc37) IV; him-5(e1490) V.
Alternate IDs: WB-STRAIN:ST54, CGC_ST54
Notes: Made_by: Takashi Fujii|"Various epidermal defects. In male tails, ray 1 is dislocated anteriorly."
Proper citation: RRID:WB-STRAIN:WBStrain00034487 Copy
http://www.wormbase.org/db/get?name=WBStrain00034489
Source Database: WormBase (WB)
Affected Genes: WBGene00000100(ajm-1)
Genomic Alteration: WBGene00000100(ajm-1)
Availability: available
Source References: PMID:39212544
Synonyms: ncIs13.
Alternate IDs: WB-STRAIN:ST65, CGC_ST65
Notes: ncIs13 [ajm-1::GFP].
Proper citation: RRID:WB-STRAIN:WBStrain00034489 Copy
http://www.wormbase.org/db/get?name=WBStrain00034402
Source Database: WormBase (WB)
Affected Genes: WBGene00003172(mec-8)|WBGene00004895(smu-1)|WBGene00006787(unc-52)
Genomic Alteration: WBGene00003172(mec-8), WBGene00004895(smu-1), WBGene00006787(unc-52)
Availability: available
Source References: EMPTY
Synonyms: mec-8(u218) smu-1(mn602) I; unc-52(e669su250ts) II.
Alternate IDs: WB-STRAIN:SP2123, CGC_SP2123
Notes: Made_by: R Herman|"Temperature sensitive mec-8 allele, mechanosensory abnormal at 25 C. Reference: Spike CA, et al. Mol Cell Biol. 2001 Aug;21(15):4985-95."
Proper citation: RRID:WB-STRAIN:WBStrain00034402 Copy
http://www.wormbase.org/db/get?name=WBStrain00034490
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: ncIs17.
Alternate IDs: WB-STRAIN:ST66, CGC_ST66
Notes: Mutagen:Gamma rays|"ncIs17 contains [hsp-16.2::eGFP + pBluscript]. Superficially wild-type."
Proper citation: RRID:WB-STRAIN:WBStrain00034490 Copy
http://www.wormbase.org/db/get?name=WBStrain00034492
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:ST205
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00034492 Copy
http://www.wormbase.org/db/get?name=WBStrain00034450
Source Database: WormBase (WB)
Affected Genes: WBGene00004027(pie-1)
Genomic Alteration: WBGene00004027(pie-1)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:SS629
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00034450 Copy
http://www.wormbase.org/db/get?name=WBStrain00034451
Source Database: WormBase (WB)
Affected Genes: WBGene00002059(ife-1)
Genomic Alteration: WBGene00002059(ife-1)
Availability: available
Source References: EMPTY
Synonyms: ife-1(bn127) III.
Alternate IDs: WB-STRAIN:SS712, CGC_SS712
Notes: Made_by: Dunkelbarger/Strome|"Mutagen:UV/TMP"|"Temperature sensitive sterility. Should be cultured at 15C or 20C. At 25C, spermatocytes fail in cytokinesis and accumulate as multinucleate cells unable to mature to spermatids. Milder defect in oogenesis is not temperature sensitive. Oocyte production is slowed, but appear relatively normal and are fertile. Inefficient translation of several maternal mRNAs (mex-1, oma-1, pos-1, and pal-1). Eukaryotic translation initiation factor 4E (eIF4E) gene (isoform 1, germ cell specific, P granule associated; F53A2.6). Homozygous 590 bp deletion starts at nt 191 in exon 1 and extends through exon 2 and into the 3' UTR to nt 780. The deletion removes over 70% of the coding region for IFE-1, including the helices and sheets that make up the mRNA platform and a Trp residue essential for m7GTP cap binding, suggesting it is a null mutation. Deletion breakpoint determined by sequencing by SS is: aagtggcctcaacgcgttgt"
Proper citation: RRID:WB-STRAIN:WBStrain00034451 Copy
http://www.wormbase.org/db/get?name=WBStrain00034452
Source Database: WormBase (WB)
Affected Genes: WBGene00003993(pgl-2)
Genomic Alteration: WBGene00003993(pgl-2)
Availability: available
Source References: EMPTY
Synonyms: pgl-2(bn123) III.
Alternate IDs: WB-STRAIN:SS727, CGC_SS727
Notes: Fertile at all temperatures.|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00034452 Copy
http://www.wormbase.org/db/get?name=WBStrain00034454
Source Database: WormBase (WB)
Affected Genes: WBGene00003992(pgl-1)|WBGene00003993(pgl-2)|WBGene00006761(unc-24)
Genomic Alteration: WBGene00003992(pgl-1), WBGene00003993(pgl-2), WBGene00006761(unc-24)
Availability: available
Source References: EMPTY
Synonyms: pgl-2(bn123) III; pgl-1(bn101) unc-24(e138) IV.
Alternate IDs: WB-STRAIN:SS730, CGC_SS730
Notes: Mutagen:UV/TMP|"Unc. Maintain at 15C. Sterile at higher temperatures."
Proper citation: RRID:WB-STRAIN:WBStrain00034454 Copy
http://www.wormbase.org/db/get?name=WBStrain00034455
Source Database: WormBase (WB)
Affected Genes: WBGene00001073(dpy-11)|WBGene00003993(pgl-2)|WBGene00003994(pgl-3)
Genomic Alteration: WBGene00001073(dpy-11), WBGene00003993(pgl-2), WBGene00003994(pgl-3)
Availability: available
Source References: EMPTY
Synonyms: pgl-2(bn123) III; pgl-3(bn104) dpy-11(e224) V.
Alternate IDs: WB-STRAIN:SS731, CGC_SS731
Notes: Dpy. Fertile at all temperatures.|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00034455 Copy
http://www.wormbase.org/db/get?name=WBStrain00034456
Source Database: WormBase (WB)
Affected Genes: WBGene00001073(dpy-11)|WBGene00003992(pgl-1)|WBGene00003993(pgl-2)|WBGene00003994(pgl-3)|WBGene00006761(unc-24)
Genomic Alteration: WBGene00001073(dpy-11), WBGene00003992(pgl-1), WBGene00003993(pgl-2), WBGene00003994(pgl-3), WBGene00006761(unc-24)
Availability: available
Source References: EMPTY
Synonyms: pgl-2(bn123) III; pgl-1(bn101) unc-24(e138) IV; pgl-3(bn104) dpy-11(e224) V.
Alternate IDs: WB-STRAIN:SS733, CGC_SS733
Notes: Dpy. Unc. Mostly sterile at all temperatures, but a small fraction are fertile at low temperatures. Maintain at 15C.|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00034456 Copy
http://www.wormbase.org/db/get?name=WBStrain00034457
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00002229(klp-19)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00002229(klp-19)
Availability: available
Source References: PMID:36617680
Synonyms: klp-19(bn126)/mT1 [dpy-10(e128)] III.
Alternate IDs: WB-STRAIN:SS746, CGC_SS746
Notes: Heterozygotes are WT and segregate WT, Dpys (mT1 homozygotes) and L1 lethals (bn126 homozygotes). klp-19 deletion is 435 bases between TTCACAGTGTTCGTGGAGAA and GCAAGGAATCGCGCCGGCT. klp-19 deletion is lethal over hT2.|"Mutagen:UV/TMP"|"Supplementary_genotype klp-19(bn126)mT1[dpy-10(e128)] III."
Proper citation: RRID:WB-STRAIN:WBStrain00034457 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
