Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
RB1116 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031820 | Caenorhabditis elegans | egl-4(ok1105) IV. | F55A8.2b Homozygous. Outer Left Sequence: AAAGTTGGTTGTGGACGGAG. Outer Right Sequence: ACTGCACAAAAATTCGAGGC. Inner Left Sequence: AGAACCGCATCAGTTCAAGC. Inner Right Sequence: TTTTGGACGAATTTTGGAGG. Inner Primer PCR Length: 2432. Estimated Deletion Size: about 1000 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001173(egl-4) | WBGene00001173(egl-4) | WB-STRAIN:WBStrain00031820 | WormBase (WB) | WB | available | WB-STRAIN:RB1116, CGC_RB1116 | 2026-08-08 10:14:12 | 0 | |||
|
RB1128 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031832 | Caenorhabditis elegans | fcd-2(ok1145) IV. | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y41E3.9 Homozygous. Outer Left Sequence: ttataaatccctgcgccaag. Outer Right Sequence: cgaatttagccagaaatcgc. Inner Left Sequence: gggtcaaagttccccatttt. Inner Right Sequence: caaaacacagaagcgagcaa. Inner Primer PCR Length: 3228. Estimated Deletion Size: about 1200 bp." | WBGene00012767(fcd-2) | WBGene00012767(fcd-2) | WB-STRAIN:WBStrain00031832 | WormBase (WB) | WB | available | WB-STRAIN:RB1128, CGC_RB1128 | 2026-08-08 10:14:13 | 0 | |||
|
RB1126 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031830 | Caenorhabditis elegans | H06H21.9(ok1143) IV. | H06H21.9 Homozygous. Outer Left Sequence: cccatcattggctttttagc. Outer Right Sequence: ttgtaggcaccggttttagg. Inner Left Sequence: tgtctcgcttttagcgcttt. Inner Right Sequence: cacgcgattttgcagtttta. Inner Primer PCR Length: 2109. Estimated Deletion Size: about 1300 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00019165(mpz-4) | WBGene00019165(mpz-4) | WB-STRAIN:WBStrain00031830 | WormBase (WB) | WB | available | WB-STRAIN:RB1126, CGC_RB1126 | 2026-08-08 10:14:13 | 0 | |||
|
RB1133 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031837 | Caenorhabditis elegans | C48E7.6(ok1156) I. | C48E7.6 Homozygous. Outer Left Sequence: aggacaccatggggaatttt. Outer Right Sequence: tgatggatcggaaagtcaca. Inner Left Sequence: ccgagttgaaggaaagatgc. Inner Right Sequence: cgaggtgcatcatcagaaaa. Inner Primer PCR Length: 3266. Estimated Deletion Size: about 1700 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00016751(C48E7.6) | WBGene00016751(C48E7.6) | WB-STRAIN:WBStrain00031837 | WormBase (WB) | WB | available | WB-STRAIN:RB1133, CGC_RB1133 | 2026-08-08 10:14:13 | 0 | |||
|
RB1224 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031924 | Caenorhabditis elegans | C34G6.2(ok1227) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | C34G6.2 Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: agatgggatgatggagcaag. Outer Right Sequence: caagaggtccggatcaaaag. Inner Left Sequence: gctgaggttgcttaggttgc. Inner Right Sequence: atctccgaaatcgtcacgtc. Inner Primer PCR Length: 3245. Estimated Deletion Size: about 2250 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000254(bli-4)|WBGene00016419(tyr-4) | WBGene00000254(bli-4), WBGene00016419(tyr-4) | WB-STRAIN:WBStrain00031924 | WormBase (WB) | WB | available | WB-STRAIN:RB1224, CGC_RB1224 | 2026-08-08 10:14:14 | 0 | |||
|
RB1223 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031923 | Caenorhabditis elegans | sph-1(ok1199) IV/nT1 [qIs51] (IV;V). | F42G8.10 Heterozygotes are WT and GFP+. Outer Left Sequence: aaagtgaacagcaggccaac. Outer Right Sequence: attgtccatcccatcgaaga. Inner Left Sequence: aggaaaccatggctttaggc. Inner Right Sequence: gcttgtgctttcgactttcc. Inner Primer PCR Length: 2101. Estimated Deletion Size: about 1350 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00004979(sph-1)|WBGene00018361(ndub-11) | WBGene00004979(sph-1), WBGene00018361(ndub-11) | WB-STRAIN:WBStrain00031923 | WormBase (WB) | WB | available | WB-STRAIN:RB1223, CGC_RB1223 | 2026-08-08 10:14:14 | 0 | |||
|
RB1222 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031922 | Caenorhabditis elegans | R09B5.1(ok1280) V. | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"R09B5.1 Homozygous. Outer Left Sequence: ctcattgacttccgggacat. Outer Right Sequence: aatatttttggggaaaggcg. Inner Left Sequence: ctcctcttcctcgtcctcct. Inner Right Sequence: agctttgcagttccggttta. Inner Primer PCR Length: 3218. Estimated Deletion Size: about 1100 bp."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00019976(fbxa-195) | WBGene00019976(fbxa-195) | WB-STRAIN:WBStrain00031922 | WormBase (WB) | WB | available | WB-STRAIN:RB1222, CGC_RB1222 | 2026-08-08 10:14:14 | 0 | |||
|
RB1221 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031921 | Caenorhabditis elegans | his-74(ok1219) V/nT1 [qIs51] (IV;V). | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"W05B10.1 Heterozygotes are WT and GFP+. Outer Left Sequence: ttggcttatcggacagatcc. Outer Right Sequence: gtgagctcgtaatatccggc. Inner Left Sequence: aaaatgagaattgatcgcgg. Inner Right Sequence: accttgtgtgatttgcgatg. Inner Primer PCR Length: 2255. Estimated Deletion Size: about 1400 bp." | WBGene00012276(his-74) | WBGene00012276(his-74) | WB-STRAIN:WBStrain00031921 | WormBase (WB) | WB | available | WB-STRAIN:RB1221, CGC_RB1221 | 2026-08-08 10:14:14 | 0 | |||
|
RB1227 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031927 | Caenorhabditis elegans | Y49E10.20(ok1286) III. | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"Supplementary_genotype [scav-3(ok1286)]"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y49E10.20 Homozygous. Outer Left Sequence: cttcttttcgcgtgctctct. Outer Right Sequence: gacaagactagtccgccagc. Inner Left Sequence: gcgggatttcgtcaaaataa. Inner Right Sequence: tcagcaagattttctcggct. Inner Primer PCR Length: 3106. Estimated Deletion Size: about 1100 bp." | WBGene00013039(scav-3) | WBGene00013039(scav-3) | WB-STRAIN:WBStrain00031927 | WormBase (WB) | WB | available | PMID:37644339 | WB-STRAIN:RB1227, CGC_RB1227 | 2026-08-08 10:14:14 | 1 | ||
|
RB1226 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031926 | Caenorhabditis elegans | acr-18(ok1285) V. | F28F8.1 Homozygous. Outer Left Sequence: tcccacatctctcacccttc. Outer Right Sequence: gcactctccgctcatctctc. Inner Left Sequence: gtgctcttcaccgaatccat. Inner Right Sequence: atgtcaaagaaatccgaccg. Inner Primer PCR Length: 3125. Estimated Deletion Size: about 2400 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000057(acr-18) | WBGene00000057(acr-18) | WB-STRAIN:WBStrain00031926 | WormBase (WB) | WB | available | PMID:38338915 | WB-STRAIN:RB1226, CGC_RB1226 | 2026-08-08 10:14:14 | 1 | ||
|
RB1234 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031934 | Caenorhabditis elegans | clk-1(ok1247) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZC395.2 Heterozygotes are WT and GFP+. Maintain by picking GFP+ worms. ok1247 animals are homozygous viable. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: CGGGTTTCGCACTATTTTGT. Outer Right Sequence: CAGCTACCGTACCCGACATT. Inner Left Sequence: GCTGGCCCAGTACATTTGTT. Inner Right Sequence: CAGTGTTCCGGATTTCAGGT. Inner Primer PCR Length: . Estimated Deletion Size: about 1250 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype." | WBGene00000254(bli-4)|WBGene00000536(clk-1) | WBGene00000254(bli-4), WBGene00000536(clk-1) | WB-STRAIN:WBStrain00031934 | WormBase (WB) | WB | available | WB-STRAIN:RB1234, CGC_RB1234 | 2026-08-08 10:14:14 | 0 | |||
|
RB1233 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031933 | Caenorhabditis elegans | T22H9.4(ok1294) V. | Made_by: OMRF Knockout Group|"T22H9.4 Homozygous. Outer Left Sequence: gtggctgaaaattcggaaaa. Outer Right Sequence: tactgatccgcgtaaaaccc. Inner Left Sequence: aaaatcaatcggtttcagcg. Inner Right Sequence: gcggagacgttagacatggt. Inner Primer PCR Length: 2135. Estimated Deletion Size: about 600 bp."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00020708(dmd-8) | WBGene00020708(dmd-8) | WB-STRAIN:WBStrain00031933 | WormBase (WB) | WB | available | WB-STRAIN:RB1233, CGC_RB1233 | 2026-08-08 10:14:14 | 0 | |||
|
RB1232 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031932 | Caenorhabditis elegans | K04F10.1(ok1291) I. | K04F10.1 Homozygous. Outer Left Sequence: TGGTGAAATTCCATCAAGCA. Outer Right Sequence: GCATTGAGCTGTGCTGAAAA. Inner Left Sequence: AGTGGAAACCGAAGTTGTGC. Inner Right Sequence: CTCGAGCGAGTCGAGTTTTT. Inner Primer PCR Length: 2128. Estimated Deletion Size: about 1200 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00019394(K04F10.1) | WBGene00019394(K04F10.1) | WB-STRAIN:WBStrain00031932 | WormBase (WB) | WB | available | WB-STRAIN:RB1232, CGC_RB1232 | 2026-08-08 10:14:14 | 0 | |||
|
RB1230 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031930 | Caenorhabditis elegans | F49D11.9(ok1190) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | F49D11.9 Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: aattgccaactgccgattat. Outer Right Sequence: tcggggagtacacaggctac. Inner Left Sequence: aagaacttcagagttgccgc. Inner Right Sequence: cgagctccataaaatcgcat. Inner Primer PCR Length: 2923. Estimated Deletion Size: about 900 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000254(bli-4)|WBGene00018632(tag-296) | WBGene00000254(bli-4), WBGene00018632(tag-296) | WB-STRAIN:WBStrain00031930 | WormBase (WB) | WB | available | WB-STRAIN:RB1230, CGC_RB1230 | 2026-08-08 10:14:14 | 0 | |||
|
RB1238 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031938 | Caenorhabditis elegans | hmg-11(ok1303) II. | Made_by: OMRF Knockout Group|"T05A7.4 Homozygous. Outer Left Sequence: ctcgtggaagccctagacag. Outer Right Sequence: catcgggaaagtacggaaga. Inner Left Sequence: tcagatggtatgatcgccaa. Inner Right Sequence: tcagactgtcacatcgctcc. Inner Primer PCR Length: 2185. Estimated Deletion Size: about 500 bp."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001976(hmg-11) | WBGene00001976(hmg-11) | WB-STRAIN:WBStrain00031938 | WormBase (WB) | WB | available | WB-STRAIN:RB1238, CGC_RB1238 | 2026-08-08 10:14:14 | 0 | |||
|
RB1237 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031937 | Caenorhabditis elegans | B0416.1(ok1302) X. | B0416.1 Homozygous. Outer Left Sequence: gcttcaaaaatagggcctcc. Outer Right Sequence: tttatttggatcagcccagc. Inner Left Sequence: cgtcagcacgcttttaatca. Inner Right Sequence: aggtacaaattggcgacctg. Inner Primer PCR Length: 3349. Estimated Deletion Size: about 1300 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00015177(tmc-2) | WBGene00015177(tmc-2) | WB-STRAIN:WBStrain00031937 | WormBase (WB) | WB | available | WB-STRAIN:RB1237, CGC_RB1237 | 2026-08-08 10:14:14 | 1 | |||
|
RB1236 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031936 | Caenorhabditis elegans | Y110A7A.12(ok1054) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y110A7A.12 Heterozygotes are WT and GFP+. Maintain by picking GFP+ worms. ok1054 animals are homozygous viable. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Outer Left Sequence: GAAACACACAGGAACGGGAT. Outer Right Sequence: AATCGGCGTTTTTCAGAATG. Inner Left Sequence: TGGCAGAAGATGATCCAGTG. Inner Right Sequence: GCGTGGATCTCGATTACGAT. Inner Primer PCR Length: 2442. Estimated Deletion Size: about 1300 bp. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype." | WBGene00000254(bli-4)|WBGene00004959(spe-5) | WBGene00000254(bli-4), WBGene00004959(spe-5) | WB-STRAIN:WBStrain00031936 | WormBase (WB) | WB | available | WB-STRAIN:RB1236, CGC_RB1236 | 2026-08-08 10:14:14 | 0 | |||
|
RB1282 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031981 | Caenorhabditis elegans | C25E10.11(ok1380) V. | C25E10.11 Homozygous. Outer Left Sequence: cttggtgagaccggagagag. Outer Right Sequence: tggcatgcaatgtcattttt. Inner Left Sequence: agccgaccggaatatttctt. Inner Right Sequence: actaattttcgaatgccccc. Inner Primer PCR Length: 2466. Estimated Deletion Size: about 1800 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00016100(C25E10.11) | WBGene00016100(C25E10.11) | WB-STRAIN:WBStrain00031981 | WormBase (WB) | WB | available | WB-STRAIN:RB1282, CGC_RB1282 | 2026-08-08 10:14:14 | 0 | |||
|
RB1290 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031989 | Caenorhabditis elegans | npp-14(ok1389) I. | C03D6.4 Homozygous. Outer Left Sequence: ccaccaaaaagccatgaact. Outer Right Sequence: aatcggaaaatttggtgctg. Inner Left Sequence: cttcggtgcaaacggattat. Inner Right Sequence: attcgctgggaaaaattgtg. Inner Primer PCR Length: 3334. Estimated Deletion Size: about 1400 bp.|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00003800(npp-14) | WBGene00003800(npp-14) | WB-STRAIN:WBStrain00031989 | WormBase (WB) | WB | available | WB-STRAIN:RB1290, CGC_RB1290 | 2026-08-08 10:14:14 | 0 | |||
|
RB1289 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031988 | Caenorhabditis elegans | C43C3.2(ok1388) X. | C43C3.2 Homozygous. Outer Left Sequence: catacccaagtacgcgtgaa. Outer Right Sequence: tgaaagtcaactggtggcag. Inner Left Sequence: ccacgtcgcctgttaagttt. Inner Right Sequence: acagttgcagaagcgagaca. Inner Primer PCR Length: 2850. Estimated Deletion Size: about 900 bp. Breakpoint data provided by Neline Kriek 10/2004: AAGTCANCACTGGAATGCATCTGTATAAGTGTGTCGATGATCTTGGTCGCGAGTTGTTT GTTGTATTTACTTTGTACTbreakpointACGACGAACACCCGACCTGAATATAGCGAG CTAATCGCAATACGTAAGTTGTTATCATTCAAGTT.|"C43C3.2 Homozygous. Outer Left Sequence: catacccaagtacgcgtgaa. Outer Right Sequence: tgaaagtcaactggtggcag. Inner Left Sequence: ccacgtcgcctgttaagttt. Inner Right Sequence: acagttgcagaagcgagaca. Inner Primer PCR Length: 2850. Estimated Deletion Size: about 900 bp. Breakpoint data provided by Neline Kriek 10/2004: AAGTCANCACTGGAATGCATCTGTATAAGTGTGTCGATGATCTTGGTCGCGAGTTGTTTGTTGTATTTACTTTGTACTbreakpointACGACGAACACCCGACCTGAATATAGCGAGCTAATCGCAATACGTAAGTTGTTATCATTCAAGTT."|"Made_by: OMRF Knockout Group"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00008065(npr-18) | WBGene00008065(npr-18) | WB-STRAIN:WBStrain00031988 | WormBase (WB) | WB | available | PMID:38446031 | WB-STRAIN:RB1289, CGC_RB1289 | 2026-08-08 10:14:14 | 2 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
