Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 32 showing 621 ~ 640 out of 147,321 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:WB-STRAIN:WBStrain00008321

http://www.wormbase.org/db/get?name=WBStrain00008321

Source Database: WormBase (WB)
Availability: available
Synonyms: mihp-2(syb235) V.
Alternate IDs: WB-STRAIN:HBR1971, CGC_HBR1971
Notes: Complete CRISPR/Cas-9 knock-out (2317bp deletion) of the gene nlp-42(Y80D3A.10). Two times backcrossed with N2. Homozygous. Superficial wild-type.|"Complete CRISPR/Cas-9 knock-out (2317bp deletion) of the gene nlp-42(Y80D3A.10). Two times backcrossed with N2. Homozygous. Superficial wild-type.Primers for crossing: Fwd: cgagacttttaaccccgtcgInFwd: aaagcccatgacttgctgaaRev: gctcaggtggttagagggttWild-type bands: 580bp, 2652bp. Mutation band: 335bp."|"Made_by: SunyBiotech Corperation"

Proper citation: RRID:WB-STRAIN:WBStrain00008321 Copy   


  • RRID:WB-STRAIN:WBStrain00008501

http://www.wormbase.org/db/get?name=WBStrain00008501

Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00001102(dsh-2)|WBGene00003241(mig-5)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00001102(dsh-2), WBGene00003241(mig-5)
Availability: available
Synonyms: dsh-2(or302) mig-5(tm2639)/mIn1 [dpy-10(e128) mIs14] II.
Alternate IDs: WB-STRAIN:HS1795, CGC_HS1795
Notes: Heterozygotes are WT with pharyngeal GFP. Segregates WT GFP+, Dpy GFP+ (mIn1 homozygotes) and few GFP- dsh-2(or302) mig-5(tm2639) homozygotes (Sys). Pick WT GFP+ animals and check for correct segregation of progeny to maintain.

Proper citation: RRID:WB-STRAIN:WBStrain00008501 Copy   


  • RRID:WB-STRAIN:WBStrain00008469

http://www.wormbase.org/db/get?name=WBStrain00008469

Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00006808(unc-76)
Genomic Alteration: WBGene00001864(him-5), WBGene00006808(unc-76)
Availability: available
Synonyms: him-5(e1467) unc-76(e911) V; osEx67.
Alternate IDs: WB-STRAIN:HS321, CGC_HS321
Notes: osEx67 [psa-4::GFP + unc-76(+)]. Maintain by picking non-Unc. Reference: Sawa H, et al. Mol Cell. 2000 Sep;6(3):617-24.

Proper citation: RRID:WB-STRAIN:WBStrain00008469 Copy   


  • RRID:WB-STRAIN:WBStrain00008470

http://www.wormbase.org/db/get?name=WBStrain00008470

Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00006808(unc-76)
Genomic Alteration: WBGene00001864(him-5), WBGene00006808(unc-76)
Availability: available
Synonyms: him-5(e1467) unc-76(e911) V; osEx71.
Alternate IDs: WB-STRAIN:HS325, CGC_HS325
Notes: osEx71 [psa-1::GFP + unc-76(+)]. Maintain by picking non-Unc. Reference: Sawa H, et al. Mol Cell. 2000 Sep;6(3):617-24.

Proper citation: RRID:WB-STRAIN:WBStrain00008470 Copy   


  • RRID:WB-STRAIN:WBStrain00008460

http://www.wormbase.org/db/get?name=WBStrain00008460

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00001067(dpy-5)|WBGene00005077(src-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001067(dpy-5), WBGene00005077(src-1)
Availability: available
Source References: PMID:38771761
Synonyms: src-1(cj293) dpy-5(e61)
Alternate IDs: WB-STRAIN:HR1275, CGC_HR1275
Notes: Heterozygotes are WT and segregate WT, Dpy Mels and dead eggs.

Proper citation: RRID:WB-STRAIN:WBStrain00008460 Copy   


  • RRID:WB-STRAIN:WBStrain00008464

http://www.wormbase.org/db/get?name=WBStrain00008464

Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00003423(msi-1)
Genomic Alteration: WBGene00001864(him-5), WBGene00003423(msi-1)
Availability: available
Synonyms: msi-1(os1) III; him-5(e1490) V.
Alternate IDs: WB-STRAIN:HS144, CGC_HS144
Notes: 1.6 kb deletion in msi-1. Males have poor mating efficiency.|"Mutagen:UV/TMP"

Proper citation: RRID:WB-STRAIN:WBStrain00008464 Copy   


  • RRID:WB-STRAIN:WBStrain00008466

http://www.wormbase.org/db/get?name=WBStrain00008466

Source Database: WormBase (WB)
Affected Genes: WBGene00009560(psa-3)
Genomic Alteration: WBGene00009560(psa-3)
Availability: available
Synonyms: psa-3(os8) X.
Alternate IDs: WB-STRAIN:HS178, CGC_HS178
Notes: Superficially WT. Defects in asymmetric T cell division causes Psa (phasmid socket absent) phenotype.

Proper citation: RRID:WB-STRAIN:WBStrain00008466 Copy   


  • RRID:WB-STRAIN:WBStrain00008402

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00008402

Source Database: WormBase (WB)
Affected Genes: WBGene00000090(age-1)|WBGene00000091(age-2)
Genomic Alteration: WBGene00000090(age-1), WBGene00000091(age-2)
Availability: available
Source References: PMID:10219000
Synonyms: age-2(yw23) I; age-1(hx546) II.
Alternate IDs: WB-STRAIN:HG284, CGC_HG284
Notes: This double mutant exhibits a doubling of both mean and maximum lifespans at 25C compared to N2. It exhibits a longer lifespan at 25C than it does at 20C. It has somewhat reduced fertility. It has normal development time, appearance, movements and feeding behavior. It's swimming rate in liquid is slightly higher than N2. STS mapping indicates the most likely location for age-2 is on LG I.

Proper citation: RRID:WB-STRAIN:WBStrain00008402 Copy   


  • RRID:WB-STRAIN:WBStrain00008404

http://www.wormbase.org/db/get?name=WBStrain00008404

Source Database: WormBase (WB)
Affected Genes: WBGene00001609(glp-1)
Genomic Alteration: WBGene00001609(glp-1)
Availability: available
Synonyms: glp-1(e2141) III; lynEx1.
Alternate IDs: WB-STRAIN:HGA8002, CGC_HGA8002
Notes: lynEx1 [(pJG01)nhr-80p::nhr-80::GFP + myo-2p::DsRed]. Sterile at 25C. Maintain at 20C or lower. Pick animals with red pharynx to maintain. Lifespan of animals carrying the array is longer than that of glp-1 alone. Reference: Goudeau J, et al. PLoS Biol. 2011 Mar;9(3):e1000599.

Proper citation: RRID:WB-STRAIN:WBStrain00008404 Copy   


  • RRID:WB-STRAIN:WBStrain00008406

http://www.wormbase.org/db/get?name=WBStrain00008406

Source Database: WormBase (WB)
Affected Genes: WBGene00000912(daf-16)|WBGene00001609(glp-1)
Genomic Alteration: WBGene00000912(daf-16), WBGene00001609(glp-1)
Availability: available
Synonyms: daf-16(mu86) I; glp-1(e2141) III; lynEx1.
Alternate IDs: WB-STRAIN:HGA8004, CGC_HGA8004
Notes: lynEx1 [(pJG01)nhr-80p::nhr-80::GFP + myo-2p::DsRed]. Sterile at 25C. Maintain at 20C or lower. Pick animals with red pharynx to maintain. Lifespan of animals carrying the array is longer than that of daf-16; glp-1 double mutants. Reference: Goudeau J, et al. PLoS Biol. 2011 Mar;9(3):e1000599.

Proper citation: RRID:WB-STRAIN:WBStrain00008406 Copy   


  • RRID:WB-STRAIN:WBStrain00008407

http://www.wormbase.org/db/get?name=WBStrain00008407

Source Database: WormBase (WB)
Affected Genes: WBGene00000908(daf-12)|WBGene00001609(glp-1)
Genomic Alteration: WBGene00000908(daf-12), WBGene00001609(glp-1)
Availability: available
Synonyms: glp-1(e2141) III; daf-12(rh61rh411) X; lynEx1.
Alternate IDs: WB-STRAIN:HGA8005, CGC_HGA8005
Notes: lynEx1 [(pJG01)nhr-80p::nhr-80::GFP + myo-2p::DsRed]. Sterile at 25C. Maintain at 20C or lower. Pick animals with red pharynx to maintain. Lifespan of animals carrying the array is longer than that of glp-1; daf-12 double mutants. Reference: Goudeau J, et al. PLoS Biol. 2011 Mar;9(3):e1000599.

Proper citation: RRID:WB-STRAIN:WBStrain00008407 Copy   


  • RRID:WB-STRAIN:WBStrain00008490

http://www.wormbase.org/db/get?name=WBStrain00008490

Source Database: WormBase (WB)
Availability: available
Synonyms: osIs1.
Alternate IDs: WB-STRAIN:HS1337, CGC_HS1337
Notes: Mutagen:Gamma ray|"osIs1 [CYE-1::GFP (pMF101) + unc-76(+)]; probably integrated on LG II. This strain has Ste, Emb, Muv, Him phenotypes (probably dominant effects of the integration). Expression in many blast cells can be detected. Reference: Fujita et al. PLoS ONE 2, e407 (2007)."

Proper citation: RRID:WB-STRAIN:WBStrain00008490 Copy   


  • RRID:WB-STRAIN:WBStrain00008491

http://www.wormbase.org/db/get?name=WBStrain00008491

Source Database: WormBase (WB)
Availability: available
Synonyms: osIs2.
Alternate IDs: WB-STRAIN:HS1339, CGC_HS1339
Notes: Mutagen:Gamma ray|"osIs2 [CYE-1::GFP (pMF101) + unc-76(+)]; probably integrated on LG X. No dominant phenotypes observed (see HS1337). Expression in many blast cells can be detected, but much weaker than osIs1. Reference: Fujita et al. PLoS ONE 2, e407 (2007)."

Proper citation: RRID:WB-STRAIN:WBStrain00008491 Copy   


  • RRID:WB-STRAIN:WBStrain00008492

http://www.wormbase.org/db/get?name=WBStrain00008492

Source Database: WormBase (WB)
Affected Genes: WBGene00006808(unc-76)
Genomic Alteration: WBGene00006808(unc-76)
Availability: available
Synonyms: unc-76(e911) V; osEx233.
Alternate IDs: WB-STRAIN:HS1359, CGC_HS1359
Notes: osEx233 [scm::mig-5::venus + unc-76(+)]. Pick non-Unc to maintain. Reference: Mizumoto K, Sawa H. Dev Cell. 2007 Feb;12(2):287-99.

Proper citation: RRID:WB-STRAIN:WBStrain00008492 Copy   


  • RRID:WB-STRAIN:WBStrain00008495

http://www.wormbase.org/db/get?name=WBStrain00008495

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00003006(lin-17)|WBGene00003397(mom-5)
Genomic Alteration: WBGene00000254(bli-4), WBGene00003006(lin-17), WBGene00003397(mom-5)
Availability: available
Synonyms: lin-17(n3091) mom-5(ne12) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); vpIs1 X.
Alternate IDs: WB-STRAIN:HS1673, CGC_HS1673
Notes: vpIs1 [elt-3::GFP + lin-15(+)] X. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP n3091 homozygotes (Sys Unc Psa). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Yamamoto Y, et al. PLoS Genet. 2011 Oct;7(10):e1002308.

Proper citation: RRID:WB-STRAIN:WBStrain00008495 Copy   


  • RRID:WB-STRAIN:WBStrain00008496

http://www.wormbase.org/db/get?name=WBStrain00008496

Source Database: WormBase (WB)
Affected Genes: WBGene00000858(cwn-2)|WBGene00001188(egl-20)
Genomic Alteration: WBGene00000858(cwn-2), WBGene00001188(egl-20)
Availability: available
Synonyms: egl-20(n585) cwn-2(ok895) IV.
Alternate IDs: WB-STRAIN:HS1675, CGC_HS1675
Notes: Egl. Unc. Reference: Yamamoto Y, et al. PLoS Genet. 2011 Oct;7(10):e1002308.

Proper citation: RRID:WB-STRAIN:WBStrain00008496 Copy   


  • RRID:WB-STRAIN:WBStrain00008497

http://www.wormbase.org/db/get?name=WBStrain00008497

Source Database: WormBase (WB)
Affected Genes: WBGene00000857(cwn-1)|WBGene00000858(cwn-2)|WBGene00001188(egl-20)|WBGene00003029(lin-44)|WBGene00003395(mom-2)
Genomic Alteration: WBGene00000857(cwn-1), WBGene00000858(cwn-2), WBGene00001188(egl-20), WBGene00003029(lin-44), WBGene00003395(mom-2)
Availability: available
Synonyms: lin-44(n1792) zdIs5 I; cwn-1(ok546) II; egl-20(n585) cwn-2(ok895) IV/nT1 [qIs51] (IV;V); mom-2(ne874) V/nT1.
Alternate IDs: WB-STRAIN:HS1680, CGC_HS1680
Notes: zdIs5 [mec-4p::GFP + lin-15(+)] I. Homozygous nT1[qIs51] are inviable. mec-4::GFP is expressed in touch neurons. Heterozygotes are strong Egl Psa GFP+ and segregate dead eggs and non-GFP Unc Egl Psa that give only dead eggs at 25C.

Proper citation: RRID:WB-STRAIN:WBStrain00008497 Copy   


  • RRID:WB-STRAIN:WBStrain00008411

http://www.wormbase.org/db/get?name=WBStrain00008411

Source Database: WormBase (WB)
Affected Genes: WBGene00001397(fat-5)|WBGene00001399(fat-7)|WBGene00001609(glp-1)
Genomic Alteration: WBGene00001397(fat-5), WBGene00001399(fat-7), WBGene00001609(glp-1)
Availability: available
Synonyms: glp-1(e2141) III; fat-5 (tm420) fat-7 (wa36) V.
Alternate IDs: WB-STRAIN:HGA8009, CGC_HGA8009
Notes: Sterile at 25C. Maintain at 20C or lower. Reference: Goudeau J, et al. PLoS Biol. 2011 Mar;9(3):e1000599.

Proper citation: RRID:WB-STRAIN:WBStrain00008411 Copy   


  • RRID:WB-STRAIN:WBStrain00008499

http://www.wormbase.org/db/get?name=WBStrain00008499

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00003006(lin-17)|WBGene00003238(mig-1)|WBGene00003397(mom-5)
Genomic Alteration: WBGene00000254(bli-4), WBGene00003006(lin-17), WBGene00003238(mig-1), WBGene00003397(mom-5)
Availability: available
Synonyms: mig-1(e1787) lin-17(n671) mom-5(ne12) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:HS1749, CGC_HS1749
Notes: Segregates WT GFP+ heterozygotes, non-GFP Unc Sys, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Reference: Yamamoto et al. PLoS Genet. 2011 Oct;7(10):e1002308.

Proper citation: RRID:WB-STRAIN:WBStrain00008499 Copy   


  • RRID:WB-STRAIN:WBStrain00008479

http://www.wormbase.org/db/get?name=WBStrain00008479

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00006943(wrm-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00006943(wrm-1)
Availability: available
Synonyms: wrm-1(tm514) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:HS732, CGC_HS732
Notes: Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm514 homozygotes (probable embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain.

Proper citation: RRID:WB-STRAIN:WBStrain00008479 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X