Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00037720
Source Database: WormBase (WB)
Affected Genes: WBGene00013878(atfs-1)
Genomic Alteration: WBGene00013878(atfs-1)
Availability: available
Source References: PMID:33542359, PMID:37902464
Synonyms: atfs-1(gk3094) V.
Alternate IDs: WB-STRAIN:VC3201, CGC_VC3201
Notes: Mutagen:UV/TMP|"Supplementary_genotype atfs-1(gk3094)"|"This strain is homozygous for a deletion (gk3094) in ZC376.7, detectable by PCR using the following primers. External left primer: TTTCAGTCGTTTCAGGACCC. External right primer: TCATCGAGTTGATCTCACGC. Internal left primer: ATAGAAACCGCCTCCTTTCG. Internal right primer: TTCTCGGCTCGTTTCTTCTC. Internal WT amplicon: 2877 bp. Deletion size: 881 bp. Deletion left flank: ACTGGACCTCGACTCATGGCACACTAAGCC. Deletion right flank: ATCAAGTTATCTTCACGGAAAAATGTTCGA. Validation: gk3094 passed by CGH."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037720 Copy
http://www.wormbase.org/db/get?name=WBStrain00037706
Source Database: WormBase (WB)
Affected Genes: WBGene00007630(har-1)
Genomic Alteration: WBGene00007630(har-1)
Availability: available
Source References: EMPTY
Synonyms: har-1(gk3124) III.
Alternate IDs: WB-STRAIN:VC3169, CGC_VC3169
Notes: C16C10.11. External left primer: TTGGCTGCTTGTATCGATTG. External right primer: CGAAAGACTGCGAGGAAAAC. Internal left primer: GTTTCCCTGTCGTATTTCGC. Internal right primer: ATCATTGAATCCGTTGCACA. Internal WT amplicon: 855 bp. Deletion size: 260 bp. Deletion left flank: CAGACAAGTGATTTTTGAACTATTTCGTCA. Deletion right flank: TCCTTCGCCGCTCCACCACCAAGACCAGGT. Validation: gk3124 passed by CGH.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037706 Copy
http://www.wormbase.org/db/get?name=WBStrain00037717
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00008990(smgl-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00008990(smgl-1)
Availability: available
Source References: EMPTY
Synonyms: smgl-1(ok2423) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC3196, CGC_VC3196
Notes: F20G4.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2423 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCAACCAATCCAGCTTTTC. External right primer: CCAAAACGAGAAGACGGAGA. Internal left primer: TTCGACTTTTTCGGCGAT. Internal right primer: ATGGAACATCCTGATGCTGA. Internal WT amplicon: 1173 bp. Deletion size: 637 bp. Deletion left flank: TTCTAAAAATAATTAAATTAGAGTGTTAAA. Deletion right flank: CGTATGGTTGCCACGTCGCGAGATCATGAA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037717 Copy
http://www.wormbase.org/db/get?name=WBStrain00037781
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00011071(R06F6.8)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00011071(R06F6.8)
Availability: available
Source References: EMPTY
Synonyms: R06F6.8(ok1318)/mIn1 [mIs14 dpy-10(e128)] II.
Alternate IDs: WB-STRAIN:VC3391, CGC_VC3391
Notes: Mutagen:UV/TMP|"R06F6.8. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1318 homozygotes (sterile, lays unfertilized oocytes and very few fertilized eggs that don't hatch). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CGCGATAAACGTCATTTCCT. External right primer: AACGTTTTTGCGTTCCAAAT. Internal left primer: TTGATTCCTTTTGCACCACA. Internal right primer: CTTCCGAAGCATGAAAAGGA. Internal WT amplicon: 3207 bp. Deletion size: 1673 bp. Deletion left flank: CAACCGACGCATATCGACTGTCAAGTCTCT. Deletion right flank: TTAATTCTCCACGTGTTTCTTTGAAATTGG."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00037781 Copy
http://www.wormbase.org/db/get?name=WBStrain00037912
Source Database: WormBase (WB)
Affected Genes: WBGene00000714(col-141)
Genomic Alteration: WBGene00000714(col-141)
Availability: available
Source References: EMPTY
Synonyms: col-141(gk5185) V.
Alternate IDs: WB-STRAIN:VC4094, CGC_VC4094
Notes: Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5185 mutation is T->G, flanking sequences GATGATCTTCAACGACATCAACTCATTCTA and GATGAAAAGATTGAGGAGCTCAATGAGTTC.|"Made_by: Vancouver KO Group"
Proper citation: RRID:WB-STRAIN:WBStrain00037912 Copy
http://www.wormbase.org/db/get?name=WBStrain00038146
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: Whole-genome sequenced strain.
Alternate IDs: WB-STRAIN:VC20204, CGC_VC20204
Notes: Made_by: Vancouver KO Group|"Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/)."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00038146 Copy
http://www.wormbase.org/db/get?name=WBStrain00038118
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: Whole-genome sequenced strain.
Alternate IDs: WB-STRAIN:VC20176, CGC_VC20176
Notes: Made_by: Vancouver KO Group|"Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/)."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00038118 Copy
http://www.wormbase.org/db/get?name=WBStrain00038192
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: Whole-genome sequenced strain.
Alternate IDs: WB-STRAIN:VC20251, CGC_VC20251
Notes: Made_by: Vancouver KO Group|"Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/)."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00038192 Copy
http://www.wormbase.org/db/get?name=WBStrain00038210
Source Database: WormBase (WB)
Availability: available
Source References: PMID:39378880
Synonyms: Whole-genome sequenced strain.
Alternate IDs: WB-STRAIN:VC20270, CGC_VC20270
Notes: Made_by: Vancouver KO Group|"Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/)."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00038210 Copy
http://www.wormbase.org/db/get?name=WBStrain00038268
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: Whole-genome sequenced strain.
Alternate IDs: WB-STRAIN:VC20331, CGC_VC20331
Notes: Made_by: Vancouver KO Group|"Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/)."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."
Proper citation: RRID:WB-STRAIN:WBStrain00038268 Copy
https://kyotofly.kit.jp/cgi-bin/stocks/search_res_det.cgi?DB_NUM=1&DG_NUM=124200
Source Database: Drosophila Genomics and Genetic Resources (DGGR)
Affected Genes: w[1118]; P{RS3}Ziz[CB-6738-3]
Availability: Available
Synonyms: @FBal0018186:w
Alternate IDs: Flybase_FBst0326732
Notes: Fly with alternate name @FBal0018186:w
Proper citation: RRID:DGGR_124200 Copy
https://kyotofly.kit.jp/cgi-bin/stocks/search_res_det.cgi?DB_NUM=1&DG_NUM=107713
Source Database: Drosophila Genomics and Genetic Resources (DGGR)
Affected Genes: Syx1A[Delta229] ry[506] / TM3, ry[RK] Sb[1] Ser[1]
Availability: Available
Synonyms: Syx1A[Delta229] ry[506] / TM3, ry[RK] Sb[1] Ser[1]
Alternate IDs: Flybase_107713
Notes: Fly with alternate name Syx1A[Delta229] ry[506] / TM3, ry[RK] Sb[1] Ser[1] from Drosophila Genomics and Genetic Resources.
Proper citation: RRID:DGGR_107713 Copy
https://kyotofly.kit.jp/cgi-bin/stocks/search_res_det.cgi?DB_NUM=1&DG_NUM=118811
Source Database: Drosophila Genomics and Genetic Resources (DGGR)
Affected Genes: y[1] w[67c23]; PBac{y[+mDint2] w[+mC]=R70C01-LexA::p65}VK00027
Availability: Available
Synonyms: y[1] w[67c23]; PBac{y[+mDint2] w[+mC]=R70C01-LexA::p65}VK00027
Alternate IDs: Flybase_118811
Notes: Fly with alternate name y[1] w[67c23]; PBac{y[+mDint2] w[+mC]=R70C01-LexA::p65}VK00027 from Drosophila Genomics and Genetic Resources.
Proper citation: RRID:DGGR_118811 Copy
https://kyotofly.kit.jp/cgi-bin/stocks/search_res_det.cgi?DB_NUM=1&DG_NUM=118709
Source Database: Drosophila Genomics and Genetic Resources (DGGR)
Affected Genes: w[*]; P{w[+mC]=UAS-dve.A}9B2
Availability: Available
Synonyms: w[*]; P{w[+mC]=UAS-dve.A}9B2
Alternate IDs: Flybase_118709
Notes: Fly with alternate name w[*]; P{w[+mC]=UAS-dve.A}9B2 from Drosophila Genomics and Genetic Resources.
Proper citation: RRID:DGGR_118709 Copy
https://kyotofly.kit.jp/cgi-bin/stocks/search_res_det.cgi?DB_NUM=1&DG_NUM=111803
Source Database: Drosophila Genomics and Genetic Resources (DGGR)
Affected Genes: P{w[+mC]=lacW}trol[G0271] w[*] P{ry[+t7.2]=neoFRT}19A / FM7c; P{ey-FLP.N}5
Availability: Available
Synonyms: P{w[+mC]=lacW}trol[G0271] w[*] P{ry[+t7.2]=neoFRT}19A / FM7c; P{ey-FLP.N}5
Alternate IDs: Flybase_111803
Notes: Fly with alternate name P{w[+mC]=lacW}trol[G0271] w[*] P{ry[+t7.2]=neoFRT}19A / FM7c; P{ey-FLP.N}5 from Drosophila Genomics and Genetic Resources.
Proper citation: RRID:DGGR_111803 Copy
https://kyotofly.kit.jp/cgi-bin/stocks/search_res_det.cgi?DB_NUM=1&DG_NUM=111002
Source Database: Drosophila Genomics and Genetic Resources (DGGR)
Affected Genes: y[d2] w[1118] P{ry[+t7.2]=ey-FLP.N}2 P{ry[+t7.2]=GMR-lacZ.C(38.1)}TPN1; P{w[+mC]=lacW}sls[j1D7] P{ry[+t7.2]=neoFRT}80B / TM6B, P{y[+t7.7] ry[+t7.2]=Car20y}TPN1, Tb[1]
Availability: Available
Synonyms: y[d2] w[1118] P{ry[+t7.2]=ey-FLP.N}2 P{ry[+t7.2]=GMR-lacZ.C(38.1)}TPN1; P{w[+mC]=lacW}sls[j1D7] P{ry[+t7.2]=neoFRT}80B / TM6B, P{y[+t7.7] ry[+t7.2]=Car20y}TPN1, Tb[1]
Alternate IDs: Flybase_111002
Notes: Fly with alternate name y[d2] w[1118] P{ry[+t7.2]=ey-FLP.N}2 P{ry[+t7.2]=GMR-lacZ.C(38.1)}TPN1; P{w[+mC]=lacW}sls[j1D7] P{ry[+t7.2]=neoFRT}80B / TM6B, P{y[+t7.7] ry[+t7.2]=Car20y}TPN1, Tb[1] from Drosophila Genomics and Genetic Resources.
Proper citation: RRID:DGGR_111002 Copy
https://kyotofly.kit.jp/cgi-bin/stocks/search_res_det.cgi?DB_NUM=1&DG_NUM=305870
Source Database: Drosophila Genomics and Genetic Resources (DGGR)
Affected Genes: y[1] w[*]; PBac{y[+mDint2] w[+mC]=UAS-hsp-Hsap\CYP2A6.HA.1}VK00033 / TM6B, Tb[1]
Availability: Available
Synonyms: y[1] w[*]; PBac{y[+mDint2] w[+mC]=UAS-hsp-Hsap\CYP2A6.HA.1}VK00033 / TM6B, Tb[1]
Alternate IDs: Flybase_305870
Notes: Fly with alternate name y[1] w[*]; PBac{y[+mDint2] w[+mC]=UAS-hsp-Hsap\CYP2A6.HA.1}VK00033 / TM6B, Tb[1] from Drosophila Genomics and Genetic Resources.
Proper citation: RRID:DGGR_305870 Copy
https://kyotofly.kit.jp/cgi-bin/stocks/search_res_det.cgi?DB_NUM=1&DG_NUM=105666
Source Database: Drosophila Genomics and Genetic Resources (DGGR)
Affected Genes: Canton-S
Availability: Available
Synonyms: Canton-S
Alternate IDs: Flybase_105666
Notes: Fly with alternate name Canton-S from Drosophila Genomics and Genetic Resources.
Proper citation: RRID:DGGR_105666 Copy
https://kyotofly.kit.jp/cgi-bin/stocks/search_res_det.cgi?DB_NUM=1&DG_NUM=103604
Source Database: Drosophila Genomics and Genetic Resources (DGGR)
Affected Genes: w[*]; P{w[+mW.hs]=GawB}Mi-2[NP0394] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Availability: Available
Synonyms: w[*]; P{w[+mW.hs]=GawB}Mi-2[NP0394] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Alternate IDs: Flybase_103604
Notes: Fly with alternate name w[*]; P{w[+mW.hs]=GawB}Mi-2[NP0394] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1 from Drosophila Genomics and Genetic Resources.
Proper citation: RRID:DGGR_103604 Copy
https://kyotofly.kit.jp/cgi-bin/stocks/search_res_det.cgi?DB_NUM=1&DG_NUM=109182
Source Database: Drosophila Genomics and Genetic Resources (DGGR)
Affected Genes: w[1118]; wg[Sp-1] / CyO; P{w[+mC]=UAS-mblA}8
Availability: Available
Synonyms: w[1118]; wg[Sp-1] / CyO; P{w[+mC]=UAS-mblA}8
Alternate IDs: Flybase_109182
Notes: Fly with alternate name w[1118]; wg[Sp-1] / CyO; P{w[+mC]=UAS-mblA}8 from Drosophila Genomics and Genetic Resources.
Proper citation: RRID:DGGR_109182 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
