Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 30 showing 581 ~ 600 out of 40,344 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:MGI:3026744

    This resource has 1+ mentions.

The record is no longer available at this source.

Source Database: MGI, Mouse Genome Informatics MGI
Genetic Background: either: (involves: 129S1/Sv * 129X1/SvJ) or (involves: 129S1/Sv * 129X1/SvJ * C57BL/6) or (involves: 129S1/Sv * 129X1/SvJ * CD-1)
Affected Genes: Efnb3
Genomic Alteration: tm1Henk
Availability: Availability unknown check source stock center
Source References: PMID:11182083
Notes: Allele Detail: Targeted This is a legacy resource.

Proper citation: RRID:MGI:3026744 Copy   


  • RRID:MGI:3026630

    This resource has 1+ mentions.

The record is no longer available at this source.

Source Database: MGI, Mouse Genome Informatics MGI
Genetic Background: involves: C57BL/6J
Affected Genes: Frem1
Genomic Alteration: crf11
Availability: Availability unknown check source stock center
Source References: PMID:12955145, PMID:23536828
Notes: Allele Detail: Chemically induced (ENU) This is a legacy resource.

Proper citation: RRID:MGI:3026630 Copy   


The record is no longer available at this source.

Source Database: MGI, Mouse Genome Informatics MGI
Genetic Background: involves: 129P2/OlaHsd * C57BL/6
Affected Genes: P2rx3, P2rx2
Genomic Alteration: tm1Ckn
Availability: Availability unknown check source stock center
Source References: PMID:14672995
Notes: Allele Detail: Targeted This is a legacy resource.

Proper citation: RRID:MGI:2687353 Copy   


The record is no longer available at this source.

Source Database: MGI, Mouse Genome Informatics MGI
Genetic Background: involves: 129S/SvEv * C57BL/6 * CBA
Affected Genes: Hcn1
Genomic Alteration: Tg(Camk2a-cre)2Szi, tm1Kndl
Availability: Availability unknown check source stock center
Source References: PMID:14651847
Notes: Allele Detail: Transgenic, Targeted This is a legacy resource.

Proper citation: RRID:MGI:2686969 Copy   


  • RRID:MGI:2682014

    This resource has 1+ mentions.

The record is no longer available at this source.

Source Database: MGI, Mouse Genome Informatics MGI
Genetic Background: involves: 129S4/SvJae * C57BL/6
Affected Genes: Icam2
Genomic Alteration: tm1Jcgr
Availability: Availability unknown check source stock center
Source References: PMID:10023766
Notes: Allele Detail: Targeted This is a legacy resource.

Proper citation: RRID:MGI:2682014 Copy   


  • RRID:MGI:2679442

    This resource has 1+ mentions.

The record is no longer available at this source.

Source Database: MGI, Mouse Genome Informatics MGI
Genetic Background: involves: 129/Sv * C57BL/6
Affected Genes: Kcna3
Genomic Alteration: tm1Lys
Availability: Availability unknown check source stock center
Source References: PMID:12878608
Notes: Allele Detail: Targeted This is a legacy resource.

Proper citation: RRID:MGI:2679442 Copy   


https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=645568

Source Database: NCBI Taxonomy
Genetic Background: Wild type
Alternate IDs: NCBI:txid645568, NCBITaxon:645568
Notes: Lineage: cellular organisms; Archaea; Methanobacteriati; Methanobacteriota; Stenosarchaea group; Methanomicrobia; Methanotrichales; Methanotrichaceae; Methanothrix; environmental samples

Proper citation: RRID:NCBITaxon_645568 Copy   


  • RRID:NCBITaxon_9031

    This resource has 1+ mentions.

https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9031

Source Database: NCBI Taxonomy
Genetic Background: Wild type
Synonyms: Gallus gallus domesticus, Phasianus gallus
Alternate IDs: NCBI:txid9031, NCBITaxon:9031
Notes: Lineage: cellular organisms; Eukaryota; Opisthokonta; Metazoa; Eumetazoa; Bilateria; Deuterostomia; Chordata; Craniata; Vertebrata; Gnathostomata; Teleostomi; Euteleostomi; Sarcopterygii; Dipnotetrapodomorpha; Tetrapoda; Amniota; Sauropsida; Sauria; Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda; Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes; Phasianidae; Phasianinae; Gallus

Proper citation: RRID:NCBITaxon_9031 Copy   


  • RRID:NCBITaxon_7460

    This resource has 1+ mentions.

https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=7460

Source Database: NCBI Taxonomy
Genetic Background: Wild type
Synonyms: Apis mellifica
Alternate IDs: NCBI:txid7460, NCBITaxon:7460
Notes: Lineage: cellular organisms; Eukaryota; Opisthokonta; Metazoa; Eumetazoa; Bilateria; Protostomia; Ecdysozoa; Panarthropoda; Arthropoda; Mandibulata; Pancrustacea; Hexapoda; Insecta; Dicondylia; Pterygota; Neoptera; Endopterygota; Hymenoptera; Apocrita; Aculeata; Apoidea; Anthophila; Apidae; Apinae; Apini; Apis

Proper citation: RRID:NCBITaxon_7460 Copy   


  • RRID:NCBITaxon_10090

    This resource has 1+ mentions.

https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=10090

Source Database: NCBI Taxonomy
Genetic Background: Wild type
Alternate IDs: NCBI:txid10090, NCBITaxon:10090
Notes: Lineage: cellular organisms; Eukaryota; Opisthokonta; Metazoa; Eumetazoa; Bilateria; Deuterostomia; Chordata; Craniata; Vertebrata; Gnathostomata; Teleostomi; Euteleostomi; Sarcopterygii; Dipnotetrapodomorpha; Tetrapoda; Amniota; Mammalia; Theria; Eutheria; Boreoeutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus

Proper citation: RRID:NCBITaxon_10090 Copy   


  • RRID:NCBITaxon_229343

    This resource has 1+ mentions.

https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=229343

Source Database: NCBI Taxonomy
Genetic Background: Wild type
Alternate IDs: NCBI:txid229343, NCBITaxon:229343
Notes: Lineage: Viruses; unclassified bacterial viruses

Proper citation: RRID:NCBITaxon_229343 Copy   


  • RRID:NCBITaxon_6661

    This resource has 1+ mentions.

https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=6661

Source Database: NCBI Taxonomy
Genetic Background: Wild type
Alternate IDs: NCBI:txid6661, NCBITaxon:6661
Notes: Lineage: cellular organisms; Eukaryota; Opisthokonta; Metazoa; Eumetazoa; Bilateria; Protostomia; Ecdysozoa; Panarthropoda; Arthropoda; Mandibulata; Pancrustacea; Crustacea; Branchiopoda; Sarsostraca; Anostraca; Artemiidae; Artemia

Proper citation: RRID:NCBITaxon_6661 Copy   


  • RRID:NCBITaxon_9544

    This resource has 1+ mentions.

https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=9544

Source Database: NCBI Taxonomy
Genetic Background: Wild type
Synonyms: Cercopithecus mulatta
Alternate IDs: NCBI:txid9544, NCBITaxon:9544
Notes: Lineage: cellular organisms; Eukaryota; Opisthokonta; Metazoa; Eumetazoa; Bilateria; Deuterostomia; Chordata; Craniata; Vertebrata; Gnathostomata; Teleostomi; Euteleostomi; Sarcopterygii; Dipnotetrapodomorpha; Tetrapoda; Amniota; Mammalia; Theria; Eutheria; Boreoeutheria; Euarchontoglires; Primates; Haplorrhini; Simiiformes; Catarrhini; Cercopithecoidea; Cercopithecidae; Cercopithecinae; Macaca

Proper citation: RRID:NCBITaxon_9544 Copy   


https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=2829212

Source Database: NCBI Taxonomy
Genetic Background: Wild type
Alternate IDs: NCBI:txid2829212, NCBITaxon:2829212
Notes: Lineage: other entries; other sequences; artificial sequences; vectors

Proper citation: RRID:NCBITaxon_2829212 Copy   


  • RRID:MMRRC_039539-MU

    This resource has 1+ mentions.

https://www.mmrrc.org/catalog/sds.php?mmrrc_id=39539

Source Database: Mutant Mouse Resource and Research Center (MMRRC)
Genetic Background: chemically induced mutation
Affected Genes: Zfp451|Spats2l|Atf6|Tor4a|Or8j3c|Potefam1|Sqor|Dnaaf9|Hps3|Adamtsl4|Rbm12b2|Kti12|Skint11|Ncdn|Prxl2b|Lrrc8c|Chek2|Rasal1|Card11|Gm1070|Pcgf1|Bhlhe40|Acrbp|Rep15|Catsperg1|Apba2|Or51f1e|Or52s19|Tmc5|Eif3c|Mki67|Nrg1|Sin3b|Gipc1|Irx6|Tln2|Itga9|Sobp|Ros1|Stox1|Nup37|Il22|Irak3|Eml6|Or1ad1|Dnah9|Rabep1|Ankfy1|Prps1l3|A730018C14Rik|Mta1|Nt5el|Ercc6|Mphosph8|Cep20|Ttc3|Grm4|Birc6|Iws1|Kdm3b|Pcyox1l
Alternate IDs: MMRRC_39539-MU, MMRRC_039539, MMRRC_39539
Notes: Research areas: ; Mutation Type: chemically induced mutation ; Collection: Beutler Mutagenetix

Proper citation: RRID:MMRRC_039539-MU Copy   


  • RRID:WB-STRAIN:WBStrain00037056

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00037056

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00020094(wip-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00020094(wip-1)
Availability: available
Source References: EMPTY
Synonyms: wip-1(ok2435) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2053, CGC_VC2053
Notes: R144.4. Homozygous sterile or near-sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2435 homozygotes (grotty, Unc, with vulval blip). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AACGTATTCCGAAGTGCGAC. External right primer: CCATGAAGAAACCCAGGAAA. Internal left primer: TCAGAAAGATTGTTCCGGTTTT. Internal right primer: GGGGGATTGACGGACTATTT. Internal WT amplicon: 3053 bp. Deletion size: 1544 bp. Deletion left flank: AAATAAGACGGTAAAGAATTTTATCAGAAT. Deletion right flank: TCAGTTCCAAGCTCAAAACCGACTCCACCT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037056 Copy   


  • RRID:WB-STRAIN:WBStrain00037034

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00037034

Source Database: WormBase (WB)
Affected Genes: WBGene00001461(flp-18)
Genomic Alteration: WBGene00001461(flp-18)
Availability: available
Source References: EMPTY
Synonyms: flp-18(gk3063) X.
Alternate IDs: WB-STRAIN:VC2016, CGC_VC2016
Notes: Made_by: Vancouver KO Group|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y48D7A.2. External left primer: TGTGCCACTCACCGATGACAC. External right primer: CATCATCATGGCGCTACG. Internal left primer: GTCCTATCAGTACCTCATGGG. Internal right primer: CGAATACCTTGTACACGC. Internal WT amplicon: 2980 bp. Deletion size: 1312 bp. Deletion left flank: AACACACGTCAACCATGAACAAATCTGCTT. Deletion right flank: AAATTTCAAATTCATGCTTTCAAATCGACA."

Proper citation: RRID:WB-STRAIN:WBStrain00037034 Copy   


  • RRID:WB-STRAIN:WBStrain00037194

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00037194

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00018152(acs-4)
Genomic Alteration: WBGene00000254(bli-4), WBGene00018152(acs-4)
Availability: available
Source References: PMID:37164154
Synonyms: acs-4(ok2872) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2240, CGC_VC2240
Notes: F37C12.7. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2872 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGTTTCAGGCAAATTGGGT. External right primer: TTCCTGTGCTCAAGTCGTTG. Internal left primer: ATGTTTGGGAACTCGACAGC. Internal right primer: ATCCTTGAACAACAGGGCAG. Internal WT amplicon: 1170 bp. Deletion size: 335 bp. Deletion left flank: CTGAAGACCCTGATTTATTTCGCTCCTGTG. Deletion right flank: AATTTTTATTGGATTTAAAACTCATTTTAC. Insertion Sequence: CGAAATA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037194 Copy   


  • RRID:WB-STRAIN:WBStrain00037154

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00037154

Source Database: WormBase (WB)
Affected Genes: WBGene00019125(ddl-1)
Genomic Alteration: WBGene00019125(ddl-1)
Availability: available
Source References: EMPTY
Synonyms: ddl-1(ok2916) II.
Alternate IDs: WB-STRAIN:VC2193, CGC_VC2193
Notes: F59E12.10. External left primer: TCACAAGTTCTGCTTGTGGC. External right primer: GCTCACTTCAAAGTACGCCC. Internal left primer: TTCATTTTGTCTGAAAGGGAAA. Internal right primer: TGAGCCGATTGAAGAAATCC. Internal WT amplicon: 1198 bp. Deletion size: 465 bp. Deletion left flank: TTTGAAATATTTACTATAAGCCGGGTCGTC. Deletion right flank: TGGAAATATGAAAAAGGCACAAACCATATA. Insertion Sequence: TTTGATAAGAACCGTCGTAGTATGTTCTTCTGGTTTCTCTTCCACTGTTTCCTCCACGA TTTGTGAAGAGCTGGGATTCGATTCGTGAATTTCGTCTATTTCTGGTGTTGATGATGGT GTGGCGGTGGTTGATTTATCCTCCAAACCCAAACGTTGATTTATCCTCCAAAC.|"F59E12.10. External left primer: TCACAAGTTCTGCTTGTGGC. External right primer: GCTCACTTCAAAGTACGCCC. Internal left primer: TTCATTTTGTCTGAAAGGGAAA. Internal right primer: TGAGCCGATTGAAGAAATCC. Internal WT amplicon: 1198 bp. Deletion size: 465 bp. Deletion left flank: TTTGAAATATTTACTATAAGCCGGGTCGTC. Deletion right flank: TGGAAATATGAAAAAGGCACAAACCATATA. Insertion Sequence: TTTGATAAGAACCGTCGTAGTATGTTCTTCTGGTTTCTCTTCCACTGTTTCCTCCACGATTTGTGAAGAGCTGGGATTCGATTCGTGAATTTCGTCTATTTCTGGTGTTGATGATGGTGTGGCGGTGGTTGATTTATCCTCCAAACCCAAACGTTGATTTATCCTCCAAAC."|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037154 Copy   


  • RRID:WB-STRAIN:WBStrain00037158

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00037158

Source Database: WormBase (WB)
Affected Genes: WBGene00004860(sma-6)
Genomic Alteration: WBGene00004860(sma-6)
Availability: available
Source References: EMPTY
Synonyms: sma-6(ok2894) II.
Alternate IDs: WB-STRAIN:VC2197, CGC_VC2197
Notes: C32D5.2. External left primer: GCGTTGATCCAAAGGACAGT. External right primer: CAACTTTACGCTGCGATTGA. Internal left primer: TCGCAAAGCTCTGTATCGTG. Internal right primer: TCGGGGTTTTTGATCAACTC. Internal WT amplicon: 1159 bp. Deletion size: 304 bp. Deletion left flank: GTGGGAAGTTGCAATCAGGGTTGAGGTATG. Deletion right flank: GAAAAACGTCCCAGCACTTAATGAATTGAG.|"Made_by: Vancouver KO Group"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037158 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X