Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
F52G2.3(ve620[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00049359 | Caenorhabditis elegans | F52G2.3(ve620[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. | Homozygous viable. Deletion of 7573 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: atgtttttccagttgctcacggtaccttca ; Right flanking sequence: gcgggtttggtgcggtttttacgtattcag. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00049359 | WormBase (WB) | WB | unknown | 2026-07-25 10:27:05 | 0 | ||||
|
try-9(ve711[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00049450 | Caenorhabditis elegans | try-9(ve711[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 1170 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gccaggatttaccactttgtcctctcatcg ; Right flanking sequence: TGGATTTCTTCTGCACGTGCTGTGGAATGT. sgRNA #1: cagaacttctgaggaataca; sgRNA #2: CGTGGATGTCTCGGCACACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00023425(try-9) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00023425(try-9) | WB-STRAIN:WBStrain00049450 | WormBase (WB) | WB | unknown | 2026-07-25 10:27:07 | 0 | ||||
|
C02G6.1(ve714[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00049453 | Caenorhabditis elegans | C02G6.1(ve714[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. | Homozygous viable. Deletion of 3831 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: agccacttcctcgtgtattttcgtaaactt ; Right flanking sequence: atttaatttgcacttgattggaaacttttt. sgRNA #1: cagtgtaatgttaaaaggtt; sgRNA #2: ccaagctaggatatctgtgg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Homozygous viable. Deletion of 3831 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: agccacttcctcgtgtattttcgtaaactt ; Right flanking sequence: atttaatttgcacttgattggaaacttttt. sgRNA #1: cagtgtaatgttaaaaggtt; sgRNA #2: ccaagctaggatatctgtgg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00049453 | WormBase (WB) | WB | unknown | 2026-07-25 10:27:07 | 0 | ||||
|
lips-16(ve704[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00049443 | Caenorhabditis elegans | lips-16(ve704[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 1780 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GGGTATTATATAGTTCCCTTTTGTTGAGTT ; Right flanking sequence: AATATTTTATTTCAATAGACTATCAATCCG. sgRNA #1: GTGAAGGTACTGAAATTGAC; sgRNA #2: GACATCAAACTATGTATGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00012588(lips-16) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00012588(lips-16) | WB-STRAIN:WBStrain00049443 | WormBase (WB) | WB | unknown | 2026-07-25 10:27:06 | 0 | ||||
|
ZK973.11(ve706[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00049445 | Caenorhabditis elegans | ZK973.11(ve706[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. | Homozygous Unc. Deletion of 2352 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gacagtatatattagcactttgagcatttt ; Right flanking sequence: tggtgcagcacggctcggcgagcaccgctt. sgRNA #1: gagcaaaaatcttcgaataa; sgRNA #2: atcaatattcacggaacagt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00049445 | WormBase (WB) | WB | unknown | 2026-07-25 10:27:06 | 0 | ||||
|
F28E10.5(ve709[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00049448 | Caenorhabditis elegans | F28E10.5(ve709[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. | Homozygous viable. Deletion of 2743 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tccatttttatacaaatttttcaataaacg ; Right flanking sequence: gacaactattttctcatgatttaagttttt. sgRNA #1: aaaaatgttcagaatctctc; sgRNA #2: catgagtagtgcacaacggg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00049448 | WormBase (WB) | WB | unknown | 2026-07-25 10:27:06 | 0 | ||||
|
F19C7.4(ve708[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00049447 | Caenorhabditis elegans | F19C7.4(ve708[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. | Homozygous viable. Deletion of 2275 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgtgttaaacggctataaaaaattcgtcca ; Right flanking sequence: aggttcatttaagaatgcctcttattcaaa. sgRNA #1: acaactatgggacaacgtag; sgRNA #2: CTATTAGGCAGCATTCAGgt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00049447 | WormBase (WB) | WB | unknown | 2026-07-25 10:27:07 | 0 | ||||
|
F01D5.8(ve710[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00049449 | Caenorhabditis elegans | F01D5.8(ve710[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 2965 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gttcattccttgttcttctttgtcacaATG ; Right flanking sequence: CGGAAAATGAATAGgaattgttttctttct. sgRNA #1: CCACGTGGTGTACAGgttag; sgRNA #2: ACAATTGTCATCGAAGCGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00049449 | WormBase (WB) | WB | unknown | 2026-07-25 10:27:06 | 0 | ||||
|
sec-11(ve723[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1[umnIs58] I;+/hT1[unc-42(e270)] V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00049462 | Caenorhabditis elegans | sec-11(ve723[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1[umnIs58] I;+/hT1[unc-42(e270)] V. | Made_by: RG KO Group|"umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygotes are sick, Egl. Deletion of 2571 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 sick, Egl adults (ve723 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: AGTTTTCCTTATGCAACAGGACGAAGAGAC ; Right flanking sequence: GAAGGAACTTCATctgaaatgggattatgc. sgRNA #1: GCAACAGGACGAAGAGACCG; sgRNA #2: TGAACATCGCAACATCGGGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous larval lethal. Deletion of 2571 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 dead larvae (ve723 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: AGTTTTCCTTATGCAACAGGACGAAGAGAC ; Right flanking sequence: GAAGGAACTTCATctgaaatgggattatgc. sgRNA #1: GCAACAGGACGAAGAGACCG; sgRNA #2: TGAACATCGCAACATCGGGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006778(unc-42)|WBGene00006789(unc-54)|WBGene00021844(sec-11) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006778(unc-42), WBGene00006789(unc-54), WBGene00021844(sec-11) | WB-STRAIN:WBStrain00049462 | WormBase (WB) | WB | unknown | 2026-07-25 10:27:07 | 0 | ||||
|
syp-5(ve722[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00049461 | Caenorhabditis elegans | syp-5(ve722[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. | Him. Deletion of 5035 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: actaacATCGTCACTATCATCACTTTTCCT ; Right flanking sequence: TGGGACATttattgactgaaataattttaa. sgRNA #1: GAGCCAAATCAAAGGATGAC; sgRNA #2: CCTCCAAATTCAGCAGTAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00021832(syp-5) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00021832(syp-5) | WB-STRAIN:WBStrain00049461 | WormBase (WB) | WB | unknown | 2026-07-25 10:27:07 | 0 | ||||
|
Y56A3A.19(ve725[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/eT1 III;+/eT1[umnIs46] V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00049464 | Caenorhabditis elegans | Y56A3A.19(ve725[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/eT1 III;+/eT1[umnIs46] V. | Made_by: RG KO Group|"umnIs46 [myo-2p::mKate2 + NeoR, III:9421936 (intergenic)] V. Homozygous larval arrest. Deletion of 682 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve725 homozygotes), Unc-36 non-GFP mKate+ animals (eT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tcgcgtcgagacccctaaatctgtgcgcct ; Right flanking sequence: tcgggaaatgactcatcgagcctgaaaaat. sgRNA #1: ttctgatatacttttctcaa; sgRNA #2: aaaaaatttgacgggaaatc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00049464 | WormBase (WB) | WB | unknown | 2026-07-25 10:27:07 | 0 | ||||
|
+/mT1 [umnIs52] II; sftb-1(ve724[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00049463 | Caenorhabditis elegans | +/mT1 [umnIs52] II; sftb-1(ve724[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. | Made_by: RG KO Group|"umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval lethal. Deletion of 5479 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 dead larvae (ve724 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: gggattaaaatataaaaggtttcgttttct ; Right flanking sequence: atattcaaagaaatacactcaagaaactaa. sgRNA #1: atgaaaatgtgatgaaagga; sgRNA #2: tgttcattgtaaaaggatta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00001072(dpy-10)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00011605(sftb-1) | WBGene00001072(dpy-10), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00011605(sftb-1) | WB-STRAIN:WBStrain00049463 | WormBase (WB) | WB | unknown | 2026-07-25 10:27:07 | 0 | ||||
|
F44E7.4(ve715[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00049454 | Caenorhabditis elegans | F44E7.4(ve715[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. | Homozygous viable. Deletion of 3659 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGGTGCTCAAGTGGATCGACACCAATTGGC ; Right flanking sequence: aaaaaaagttttaatggcattttctgagaa. sgRNA #1: TTCAAGTCTATAGCTGCGAT; sgRNA #2: ttgactttcttctaaatacg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00049454 | WormBase (WB) | WB | unknown | 2026-07-25 10:27:06 | 0 | ||||
|
Y48B6A.1(ve717[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00049456 | Caenorhabditis elegans | Y48B6A.1(ve717[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. | Made_by: RG KO Group|"umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous larval arrest. Deletion of 3274 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve717 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ataataacaaaagaaaacgaaggtgtaaca ; Right flanking sequence: cccaacatttttccgatttcaatttctctt. sgRNA #1: aataaaaacaaagaacaacg; sgRNA #2: cctaaaatcgcgacgcacta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00001072(dpy-10)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006787(unc-52)|WBGene00006789(unc-54) | WBGene00001072(dpy-10), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006787(unc-52), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00049456 | WormBase (WB) | WB | unknown | 2026-07-25 10:27:07 | 0 | ||||
|
elpc-4(ve720[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00049459 | Caenorhabditis elegans | elpc-4(ve720[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. | Homozygous viable. Deletion of 1058 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tatttttaaagtaatttcagaATGTTGAAC ; Right flanking sequence: GCATTTGATGAGCCAGCTCCAGGTCATCAA. sgRNA #1: aatttcagaATGTTGAACGT; sgRNA #2: GCTGGCTCATCAAATGCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00016128(elpc-4) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00016128(elpc-4) | WB-STRAIN:WBStrain00049459 | WormBase (WB) | WB | unknown | 2026-07-25 10:27:07 | 0 | ||||
|
+/nT1[umnIs49] IV; ZK856.11(ve701[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00049440 | Caenorhabditis elegans | +/nT1[umnIs49] IV; ZK856.11(ve701[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. | Made_by: RG KO Group|"umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Mid-larval arrest, arrested larvae are somewhat Dpy. Deletion of 980 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested somewhat Dpy larvae (ve701 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aggcagcaggcgcataaacaggaaagtaaa ; Right flanking sequence: tcaggtttaaaaaaaattgagttttaagtt. sgRNA #1: cataaacaggaaagtaaagg; sgRNA #2: GTAGCAGCAGACATgatttc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00049440 | WormBase (WB) | WB | unknown | 2026-07-25 10:27:06 | 0 | ||||
|
ZK792.5(ve699[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00049438 | Caenorhabditis elegans | ZK792.5(ve699[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. | Made_by: RG KO Group|"umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous sterile. Deletion of 3088 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate sterile adults (ve699 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ccctttttgtttgccaagattatcagatga ; Right flanking sequence: TGTGGCTTCTTCTCAGCATCAGCAGCAGCA. sgRNA #1: gccaagattatcagatgatc; sgRNA #2: AAATTGTTTCTCTCCTCCTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00049438 | WormBase (WB) | WB | unknown | 2026-07-25 10:27:07 | 0 | ||||
|
snrp-200(ve734[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00049471 | Caenorhabditis elegans | snrp-200(ve734[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. | Made_by: RG KO Group|"umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous larval lethal. Deletion of 9661 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 dead larvae (ve734 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ttgaaaagaataataataataatacaaata ; Right flanking sequence: aggttaaaaaaatcaaaacaagaaataaaa. sgRNA #3: gaccagggagtgggtgacgg; sgRNA #4: GAATCCAGCAGTATGAGTAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation." | WBGene00001072(dpy-10)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006787(unc-52)|WBGene00006789(unc-54)|WBGene00012896(snrp-200) | WBGene00001072(dpy-10), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006787(unc-52), WBGene00006789(unc-54), WBGene00012896(snrp-200) | WB-STRAIN:WBStrain00049471 | WormBase (WB) | WB | unknown | 2026-07-25 10:27:07 | 0 | ||||
|
Y39B6A.3(ve735[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00049472 | Caenorhabditis elegans | Y39B6A.3(ve735[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ V. | Homozygous early larval arrest as an unbalanced heterozygote. Deletion of 852 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type dim GFP+, and segregate wild-type dim GFP+, bright GFP+arrested larvae (ve735 homozygotes) and non-GFP wild-type homozygotes. Maintain by picking wild-type dim GFP+.Left flanking Sequence: tttattagcattttttctagaatgtacacg ; Right flanking sequence: tttttttctgtaaattttttacgaaaatat. sgRNA #3: CGTCACCGATAAGCTATCGT; sgRNA #4: ggtaaactacacgcgtggcc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.Note: This allele cannot be balanced by sC4 because it is contained within a deleted region. See Maroilley et al. Sci Reports (2021)11:18258 for more details. doi.org/10.1038/s41598-021-97764-9|"Homozygous early larval arrest. Deletion of 852 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+arrested larvae (ve735 homozygotes) and arrested non-GFP (stage unknown) (sC4 homozygotes). Maintain by picking wild-type GFP+.Left flanking Sequence: tttattagcattttttctagaatgtacacg ; Right flanking sequence: tttttttctgtaaattttttacgaaaatat. sgRNA #3: CGTCACCGATAAGCTATCGT; sgRNA #4: ggtaaactacacgcgtggcc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00049472 | WormBase (WB) | WB | unknown | 2026-07-25 10:27:07 | 0 | ||||
|
gtf-2F2(ve732[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00049469 | Caenorhabditis elegans | gtf-2F2(ve732[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ V. | Homozygous sterile deletion as an unbalanced het. Deletion of 3148 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type dim GFP+, and segregate wild-type dim GFP+, bright GFP+adult sterile animals (ve732 homozygotes) and non-GFP wild-type homozygotes. Maintain by picking wild-type dim GFP+. Left flanking Sequence: GCAGGGACTCGGTGCAGATGCTCCAATCAA ; Right flanking sequence: tgggttatttagcccagttttctatttatt. sgRNA #3: AACTGGAAAACTGGCAATTG; sgRNA #4: AGGCACCACAGAGACTTGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.Note: This allele cannot be balanced by sC4 because it is contained within a deleted region. See Maroilley et al. Sci Reports (2021)11:18258 for more details. doi.org/10.1038/s41598-021-97764-9|"Homozygous sterile. Deletion of 3148 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+adult sterile animals (ve732 homozygotes) and arrested non-GFP (stage unknown) (sC4 homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: GCAGGGACTCGGTGCAGATGCTCCAATCAA ; Right flanking sequence: tgggttatttagcccagttttctatttatt. sgRNA #3: AACTGGAAAACTGGCAATTG; sgRNA #4: AGGCACCACAGAGACTTGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00049469 | WormBase (WB) | WB | unknown | 2026-07-25 10:27:07 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
