Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5509994
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Alternate IDs: 5509994
Notes: This strain was produced by injecting ZFNS targeting the sequence ctcccccatcccacttgaatgtggagcagcctgtg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp deletion in exon 7 in SS/JrHsdMcwi.
Proper citation: RRID:RGD_5509994 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5509988
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Alternate IDs: 5509988
Notes: This strain was produced by injecting ZFNs targeting the sequence TTCCCAATTCGTCACAgaagctGCTGGAGCTGATAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 138-bp deletion of part of intron 1 and exon 2.
Proper citation: RRID:RGD_5509988 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=6483453
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Alternate IDs: 6483453
Notes: This allele was made by ZFN mutagenesis. The resulting mutation is a 37-bp frameshift deletion in exon 1 (del 74-110)
Proper citation: RRID:RGD_6483453 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5686766
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Alternate IDs: 5686766
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.
Proper citation: RRID:RGD_5686766 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5686322
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Alternate IDs: 5686322
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.
Proper citation: RRID:RGD_5686322 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5688107
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Alternate IDs: 5688107
Notes: ZFN mutant founders were backcrossed with FHH-Chr 1BN/Mcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. The resulting mutation is a 14-bp frameshift deletion mutation in exon 7.
Proper citation: RRID:RGD_5688107 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054304
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Alternate IDs: 10054304
Notes: CRISPR/Cas9 system was used to introduce a 2-bp deletion in the Btg2 gene of SS.BN-(D13Rat25-rs106935835)/Mcwi rat embryos Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_10054304 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054299
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Alternate IDs: 10054299
Notes: CRISPR/Cas9 system was used to introduce a 16-bp deletion in the Btg2 gene of SS.BN-(D13Rat25-rs106935835)/Mcwi rat embryos. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_10054299 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11553894
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Alternate IDs: 11553894
Notes: ZFN system was used to introduce a mutation in the Tpcn2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 9-bp deletion in Exon 4 of theTpcn2 gene. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_11553894 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10059576
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Alternate IDs: 10059576
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Sik2 gene of WKY/NCrl rat embryos. The resulting mutation is a 4-bp deletion in exon 4 of the Sik2 gene. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_10059576 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11553850
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Alternate IDs: 11553850
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Trpv4 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp deletion in Exon 4 of the Trpv4 gene. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_11553850 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12790599
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Alternate IDs: 12790599
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Asic3 gene of WKY/Ncrlrat embryos. The resulting mutation is a 61-bp deletion in the exon 1 of the Asic3 gene. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_12790599 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11553875
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Alternate IDs: 11553875
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Fmr1 gene of Crl:LE rat embryos. The resulting mutation is a 2-bp deletion in exon 8 of the Fmr1 gene. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_11553875 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12790610
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Alternate IDs: 12790610
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Cd14 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a net 7-bp deletion of the Cd14 gene. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_12790610 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12790692
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Alternate IDs: 12790692
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Pon1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp insertion of exon 4 in the Pon1 gene. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_12790692 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11553902
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Alternate IDs: 11553902
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Trpc6 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 18-bp deletion in Exon 2 of the Trpc6 gene. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_11553902 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12790627
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Alternate IDs: 12790627
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Igh-6 gene of LEW/NCrl rat embryos. The resulting mutation is a 8-bp deletion in the exon 2 of the Igh-6 gene. Contact MCW rat distribution at [email protected]
Proper citation: RRID:RGD_12790627 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12738365
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Alternate IDs: 12738365
Notes: This strain was produced by injecting TALENs targeting the sequence into Crl:SD rat embryos. The resulting mutation is a 10-bp frameshift deletion,Atgttgagat, in exon 2.
Proper citation: RRID:RGD_12738365 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12790717
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Alternate IDs: 12790717
Notes: This strain was produced by targeting the Rfwd2 sequence in SS/JrHsdMcwi rat embryos. The resulting mutation is a 6-bp insertion ( 7-bp insertion in the 1-bp deletion site) in exon 4.
Proper citation: RRID:RGD_12790717 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=12790713
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Alternate IDs: 12790713
Notes: This strain was produced by targeting the Rag2 sequence in SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in exon 2.
Proper citation: RRID:RGD_12790713 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
