SYSTEM UPDATE: We will be performing system maintenace Saturday September 26 at 9pm to midnight Pacific Time

Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Background:mutant (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

1,464 Results - per page

Show More Columns | Download Top 1000 Results

Organism Name Proper Citation Species Synonyms Notes Phenotype Affected Gene Genomic Alteration Catalog Number Background Database Database Abbreviation Availability Source References Alternate IDs Record Last Update Mentions Count
LE-Tg(Pvalb-cre)2-28Koba
 
Resource Report
Resource Website
RRID:RGD_39128171 Rattus norvegicus This strain is established by injection of modified BAC (cre gene was inserted into the exon 2 of mouse Pvalb gene) into Long-Evans rat's fertile eggs. National BioResource Project for the Rat in Japan 39128171 mutant Rat Genome Database (RGD) RGD Live Animals; Cryopreserved Sperm (as of 2020-09-23) 39128171 2026-09-19 01:18:50 0
SD-Bckdkm1Dbsa
 
Resource Report
Resource Website
RRID:RGD_39457947 Rattus norvegicus The frogleg phenotype arose in a breeding colony of Sprague-Dawley rats which had originated with animals purchased from Taconic Farms (Hamilton, NY). The frogleg rats, which require no special husbandry, were bred and maintained at Spring Valley Laboratories, Inc (Woodbine,MD). The complex phenotype seen in the frogleg rat arises from a missense mutation (p.G369E) in the gene Bckdk. 39457947 mutant Rat Genome Database (RGD) RGD Unknown 39457947 2026-09-19 01:18:52 0
SD.BN-Aireem1Ang-/-
 
Resource Report
Resource Website
RRID:RGD_38599147 Rattus norvegicus The BN homozygous Aire mutant rats were derived from founder rats that were backcrossed in a Sprague Dawley (SD; outbred strain) background for six generations to obtain AIRE-deficient SD rats. The original founder were from BN mutants carrying the mutations created by ZFN reagents targeting to a DNA sequence 59-TGCCACCCAGACCCCCCACAAAGAGAAGAGCCCTGGAAGAG- 39 in exon 3 of the Aire gene. This mutant carriesa 17-bp deletion in the nuclear localization signal sequence, causing a premature stop codon. 38599147 mutant Rat Genome Database (RGD) RGD Unknown 38599147 2026-09-19 01:18:51 0
SD-Rag1/Rag2em1Mlit
 
Resource Report
Resource Website
RRID:RGD_38548914 Rattus norvegicus The Rag1, Rag2 double-knock rats were obtained by injecting the mixture of Rag1- and Rag2-targeting sgRNA into 1-cell embryo. The resulted mutations were a 1564-bp deletion in Rag1 and 85-bp deletion in Rag2. 38548914 mutant Rat Genome Database (RGD) RGD Unknown 38548914 2026-09-19 01:18:52 0
SD-Rag1/Rag2em1MlitIl2rgem1Mlit-/y
 
Resource Report
Resource Website
RRID:RGD_38548916 Rattus norvegicus The Rag1, Rag2, and Il2rg triple-knockout rats were obtained by intercrossing Rag1 and Rag2 double-knockout rat (RGD:38548914) with Il2rg knockout rat (RGD:38548915). 38548916 mutant Rat Genome Database (RGD) RGD Unknown 38548916 2026-09-19 01:18:52 0
SS-Rictorem4Mcwi
 
Resource Report
Resource Website
RRID:RGD_25330091 Rattus norvegicus CRISPR/Cas9 system was used to introduce a 11-bp deletion in exon 19 of rat Rictor gene. Contact MCW rat distribution at [email protected] 25330091 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2021-11-03) 25330091 2026-09-19 01:18:51 0
LE-Dyrk1aem3Mcwi
 
Resource Report
Resource Website
RRID:RGD_25394526 Rattus norvegicus The rat strain was produced by injecting CRISPR/Cas9 targeting rat Dyrk1a into Crl:LE embryos. The result is a 5-bp deletion in exon 3 of the gene. Autism Rat Model Resource. Contact MCW rat distribution at [email protected] 25394526 mutant Rat Genome Database (RGD) RGD Unknown 25394526 2026-09-19 01:18:51 0
SD-Cyp2c11em1Nju
 
Resource Report
Resource Website
RRID:RGD_150429707 Rattus norvegicus CRISPR/Cas9 system containing two pairs of single guide RNA (sgRNA) primers: sgRNA1 (forward primer: 59-GCTACTG- TAACTGACATGTT-39; reverse primer: 59-AACATGTCAGTTACAGTAGC- 39) and sgRNA2 (forward primer: 59-TCAAGGGTAAACTCAGACTG-39; reverse primer: 59-CAGTCTGAGTTTACCCTTGA-39), was injected to Sprague-Dawley rat one-cell embryos. The F0 pups were screened by genomic DNA sequencing to identify heterozygous CYP2C11+/2 founders.This mutant strain carries a two base pairs (GT) insertion into exon 6 of CYP2C11 and resulting in the knockout allele. 150429707 mutant Rat Genome Database (RGD) RGD Unknown 150429707 2026-09-19 01:18:51 0
SS-Kcnj2em2Mcwi
 
Resource Report
Resource Website
RRID:RGD_14394494 Rattus norvegicus CRISPR/Cas9 system was used to introduce a 28-bp deletion mutation in exon 1 of the Kcnj2 gene of SS/JrHsdMcwi rat embryos. Contact MCW rat distribution at [email protected] 14394494 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2019-03-22) 14394494 2026-09-19 01:18:51 0
LE-Cyfip1em1Sage+/-
 
Resource Report
Resource Website
RRID:RGD_14985210 Rattus norvegicus The bioinformatics software (Horizon Discovery, St. Louis, USA) was used to design a short guide RNA (sgRNA) targeting a Protospacer Adjacent Motif (PAM) sequence within exon 7 of the rat Cyfip1gene (GGCAGATCCACAATCCATCCagg) on chromosome 1 (first 21 of 32 exons, Refseq: NC_005100.4, NM_001107517.1).sgRNA-Cas9 was performed by nucleofecting the sgRNA-Cas9 into rat C6 glial cells. Genomic DNA (gDNA) PCR products were subsequently generated from nucleofected C6 cells using primers flanking the sgRNA site (FOR: GCCAAAGCTTCCCCTAAAGT; REV: TGGGCGTCAAGTACATTCTG; 497bp amplicon). Embryos were collected from donor female Long Evans rats and injected with the validated sgRNA-Cas9. Then implanted into synchronized pseudopregnant Long Evans recipient female This mutant carries 4bp out of frame heterozygous deletion in exon 7 of the Cyfip1, resulting bioinformatics prediction of an early stop codon in exon 8. 14985210 mutant Rat Genome Database (RGD) RGD Unknown 14985210 2026-09-19 01:18:52 0
SD-Dnmt1tm1(Myh6-cre)Cqin
 
Resource Report
Resource Website
1+ mentions
RRID:RGD_126925139 Rattus norvegicus To specifically knockout Dnmt1 in the myocardium, Cre-loxP system was used by crossing alpha -MHC-Cre rats with Dnmt1 cKO rats. Dnmt1+/- offspring positive for the alpha MHC-Cre transgene (double-positive) were selected. In the second round of crossbreeding, the double-positive rats were crossed with Dnmt1 cKO rats, and Dnmt1-/- offspring positive for the alpha MHC-Cre transgene were obtained as myocardium-specific Dnmt1-KO rats 126925139 mutant Rat Genome Database (RGD) RGD Unknown 126925139 2026-09-19 01:18:52 1
F344-Atg16l1em8Rrrc
 
Resource Report
Resource Website
1+ mentions
RRID:RGD_149735570 Rattus norvegicus CRISPR-Cas9-mediated knock-in of a single base pair polymorphism of guanine to alanine in exon 10, resulting in a threonine to alanine substitution at amino acid position 299 in the rat. Mimics the same nucleotide substitution for the threonine to alanine substitution at amino acid position 300 in humans (T300A), Homozygosity for this allele is embryonic lethal. RRRC 149735570 mutant Rat Genome Database (RGD) RGD Live Animals (as of 2021-07-23) 149735570 2026-09-19 01:18:52 1
SD-Lrp5em3Vari
 
Resource Report
Resource Website
RRID:RGD_41404651 Rattus norvegicus CRISPR/Cas9 system was used to introduce an inversion coupled with small deletions in the exon 2 at both the sgRNA1 (11 bp) and sgRNA2 sites (3 bp) in the rat Lrp5 gene of Crl:SD embryos. 41404651 mutant Rat Genome Database (RGD) RGD Unknown 41404651 2026-09-19 01:18:52 0
WI.SD-PcloTn(sb-B-Geo)Fkh
 
Resource Report
Resource Website
RRID:RGD_41408339 Rattus norvegicus The Sprague-Dawley transposon mutagenesis spermatogonial gene trap library was screen to generate rats with a disrupted Pclo gene in Wistar rat background. The transposon element was integrated into exon 3 of the Pclo genomic sequence, leading to a premature stop in the reading frame. 41408339 mutant Rat Genome Database (RGD) RGD Unknown 41408339 2026-09-19 01:18:51 0
W-Phf24em24Iexas
 
Resource Report
Resource Website
RRID:RGD_38676452 Rattus norvegicus This strain was establishe by CRISPR-Cas9 system at Osaka University. Target sequence is CCATGGGGGTGTTGATGTCCAAG (CCA is PAM sequence). Back ground strain is Crlj:Wistar (WI). This strain is line No. 24 and has a 141-bp deletion in Phf24 gene. Off-target effects (214 candidate region) have not yet been examined. National BioResource Project for the Rat in Japan 38676452 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2020-09-17) 38676452 2026-09-19 01:18:52 0
F344; W-Phf24em6(EGFP)Iexas
 
Resource Report
Resource Website
RRID:RGD_38676453 Rattus norvegicus This strain (line No. 6) was establishe by CRISPR-Cas9 system at Osaka University and EGFP sequence was knock-in in Phf24 gene. Back ground strain is Crlj:Wistar (WI). Founder rats were crossed with F344/NSlc, and this strain was maintained by crossing with F344/NSlc (F2 or F3 generation, November 2017). At the point of sperm cryopreservation, this strain is not "congenic" strain (backcross generation was <5 generations), but background is mix of Crlj:Wistar and F344/NSlc. National BioResource Project for the Rat in Japan 38676453 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2020-09-17) 38676453 2026-09-19 01:18:52 0
SS-Prr5em1Mcwi
 
Resource Report
Resource Website
RRID:RGD_14398463 Rattus norvegicus CRISPR/Cas9 system was used to introduce a mutation in the Prr5 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 19-bp deletion in the exon 1 of the gene. Contact MCW rat distribution at [email protected] 14398463 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2019-04-19) 14398463 2026-09-19 01:18:51 0
F344-Phf24em2Kyo
 
Resource Report
Resource Website
RRID:RGD_38676450 Rattus norvegicus In 2013, F344/Stm female rat deleted 392b (delta392) of KIAA1045 (Phf24) was generated by Platinum TALEN methods. Although spontaneous GTCS is not observed, seizure susceptibility is increased and kindling induced by PTZ is promoted. In addition, locomotor activity is increased, disturbed behavior and spacial memory are decreased, and emotional behavior is increased due to unpleasant stimulation. National BioResource Project for the Rat in Japan 38676450 mutant Rat Genome Database (RGD) RGD Live Animals; Cryopreserved Sperm (as of 2021-07-01) 38676450 2026-09-19 01:18:52 0
WI-Prdm14em10Nips
 
Resource Report
Resource Website
RRID:RGD_41457452 Rattus norvegicus Prdm14 mutation was induced by introducing ribonucleic complexes (crRNA, tract RNA and Cas9 protein) into Crlj:WI rat embryos using electroporator. The resulting mutation is a 4412-bp deletion in exon 1 to 4. Homozygous Prdm14 knocked-out rats have the germ cell-deficient phenotype. Section of Mammalian Transgenesis, Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN 41457452 mutant Rat Genome Database (RGD) RGD Live Animals; Cryopreserved Embryo; Cryopreserved Sperm (as of 2021-02-24) 41457452 2026-09-19 01:18:52 0
SD-Lrp5em1Vari
 
Resource Report
Resource Website
RRID:RGD_41404646 Rattus norvegicus CRISPR/Cas9 system was used to introduce a 18-bp deletion of exon 2 in the rat Lrp5 gene of Crl:SD embryos. 41404646 mutant Rat Genome Database (RGD) RGD Unknown 41404646 2026-09-19 01:18:52 0

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.