Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00008314
Source Database: WormBase (WB)
Availability: available
Synonyms: C10C6.7(goe5) IV.
Alternate IDs: WB-STRAIN:HBR764, CGC_HBR764
Notes: goe5 is a 4 bp deletion in the second exon causing a frame shift and presumptive molecular null allele. sgRNA target sequence: GTTATGGTGAGAAGGAAAGCtgg Reference: Turek et al. eLife 2016;5:e12499.|"Made_by: Lewandrowski & Turek"
Proper citation: RRID:WB-STRAIN:WBStrain00008314 Copy
http://www.wormbase.org/db/get?name=WBStrain00008315
Source Database: WormBase (WB)
Affected Genes: WBGene00002988(lim-6)
Genomic Alteration: WBGene00002988(lim-6)
Availability: available
Synonyms: lim-6(tm4836) X.
Alternate IDs: WB-STRAIN:HBR914, CGC_HBR914
Notes: Complete lack of behavioral quiescence during sleep. Reference: Turek et al. eLife 2016;5:e12499.
Proper citation: RRID:WB-STRAIN:WBStrain00008315 Copy
http://www.wormbase.org/db/get?name=WBStrain00008316
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Synonyms: unc-119(ed3) III; goeEx361.
Alternate IDs: WB-STRAIN:HBR986, CGC_HBR986
Notes: goeEx361 [ceh-24p::ReaChr::mKate2::unc-54 3'UTR + unc-119(+)]. Pick non-Unc to maintain. Reporter expresses ReaChr with expression control mKate2. Reference: Schwarz J & Bringmann H. eLife 2017;10.7554/eLife.24846.
Proper citation: RRID:WB-STRAIN:WBStrain00008316 Copy
http://www.wormbase.org/db/get?name=WBStrain00008319
Source Database: WormBase (WB)
Availability: available
Synonyms: goeIs247.
Alternate IDs: WB-STRAIN:HBR1077, CGC_HBR1077
Notes: goeIs247 [ceh-24p::GCaMP6s::mKate2::unc-54 3'UTR + unc-119(+)]. Reporter expresses calcium sensor GCaMP6s with expression control mKate2. Reference: Schwarz J & Bringmann H. eLife 2017;10.7554/eLife.24846.
Proper citation: RRID:WB-STRAIN:WBStrain00008319 Copy
http://www.wormbase.org/db/get?name=WBStrain00008320
Source Database: WormBase (WB)
Availability: available
Synonyms: goeIs288.
Alternate IDs: WB-STRAIN:HBR1261, CGC_HBR1261
Notes: goeIs288 [flp-11p::mKate2::unc-54 3'UTR + unc-119(+)]. Low copy number insertion. Integration site unknown, but likely not in LG II. Reference: Turek et al. eLife 2016;5:e12499.
Proper citation: RRID:WB-STRAIN:WBStrain00008320 Copy
http://www.wormbase.org/db/get?name=WBStrain00008321
Source Database: WormBase (WB)
Availability: available
Synonyms: mihp-2(syb235) V.
Alternate IDs: WB-STRAIN:HBR1971, CGC_HBR1971
Notes: Complete CRISPR/Cas-9 knock-out (2317bp deletion) of the gene nlp-42(Y80D3A.10). Two times backcrossed with N2. Homozygous. Superficial wild-type.|"Complete CRISPR/Cas-9 knock-out (2317bp deletion) of the gene nlp-42(Y80D3A.10). Two times backcrossed with N2. Homozygous. Superficial wild-type.Primers for crossing: Fwd: cgagacttttaaccccgtcgInFwd: aaagcccatgacttgctgaaRev: gctcaggtggttagagggttWild-type bands: 580bp, 2652bp. Mutation band: 335bp."|"Made_by: SunyBiotech Corperation"
Proper citation: RRID:WB-STRAIN:WBStrain00008321 Copy
http://www.wormbase.org/db/get?name=WBStrain00008501
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00001102(dsh-2)|WBGene00003241(mig-5)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00001102(dsh-2), WBGene00003241(mig-5)
Availability: available
Synonyms: dsh-2(or302) mig-5(tm2639)/mIn1 [dpy-10(e128) mIs14] II.
Alternate IDs: WB-STRAIN:HS1795, CGC_HS1795
Notes: Heterozygotes are WT with pharyngeal GFP. Segregates WT GFP+, Dpy GFP+ (mIn1 homozygotes) and few GFP- dsh-2(or302) mig-5(tm2639) homozygotes (Sys). Pick WT GFP+ animals and check for correct segregation of progeny to maintain.
Proper citation: RRID:WB-STRAIN:WBStrain00008501 Copy
http://www.wormbase.org/db/get?name=WBStrain00008469
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00006808(unc-76)
Genomic Alteration: WBGene00001864(him-5), WBGene00006808(unc-76)
Availability: available
Synonyms: him-5(e1467) unc-76(e911) V; osEx67.
Alternate IDs: WB-STRAIN:HS321, CGC_HS321
Notes: osEx67 [psa-4::GFP + unc-76(+)]. Maintain by picking non-Unc. Reference: Sawa H, et al. Mol Cell. 2000 Sep;6(3):617-24.
Proper citation: RRID:WB-STRAIN:WBStrain00008469 Copy
http://www.wormbase.org/db/get?name=WBStrain00008470
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00006808(unc-76)
Genomic Alteration: WBGene00001864(him-5), WBGene00006808(unc-76)
Availability: available
Synonyms: him-5(e1467) unc-76(e911) V; osEx71.
Alternate IDs: WB-STRAIN:HS325, CGC_HS325
Notes: osEx71 [psa-1::GFP + unc-76(+)]. Maintain by picking non-Unc. Reference: Sawa H, et al. Mol Cell. 2000 Sep;6(3):617-24.
Proper citation: RRID:WB-STRAIN:WBStrain00008470 Copy
http://www.wormbase.org/db/get?name=WBStrain00008460
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00001067(dpy-5)|WBGene00005077(src-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001067(dpy-5), WBGene00005077(src-1)
Availability: available
Source References: PMID:38771761
Synonyms: src-1(cj293) dpy-5(e61)
Alternate IDs: WB-STRAIN:HR1275, CGC_HR1275
Notes: Heterozygotes are WT and segregate WT, Dpy Mels and dead eggs.
Proper citation: RRID:WB-STRAIN:WBStrain00008460 Copy
http://www.wormbase.org/db/get?name=WBStrain00008464
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00003423(msi-1)
Genomic Alteration: WBGene00001864(him-5), WBGene00003423(msi-1)
Availability: available
Synonyms: msi-1(os1) III; him-5(e1490) V.
Alternate IDs: WB-STRAIN:HS144, CGC_HS144
Notes: 1.6 kb deletion in msi-1. Males have poor mating efficiency.|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00008464 Copy
http://www.wormbase.org/db/get?name=WBStrain00008466
Source Database: WormBase (WB)
Affected Genes: WBGene00009560(psa-3)
Genomic Alteration: WBGene00009560(psa-3)
Availability: available
Synonyms: psa-3(os8) X.
Alternate IDs: WB-STRAIN:HS178, CGC_HS178
Notes: Superficially WT. Defects in asymmetric T cell division causes Psa (phasmid socket absent) phenotype.
Proper citation: RRID:WB-STRAIN:WBStrain00008466 Copy
http://www.wormbase.org/db/get?name=WBStrain00008402
Source Database: WormBase (WB)
Affected Genes: WBGene00000090(age-1)|WBGene00000091(age-2)
Genomic Alteration: WBGene00000090(age-1), WBGene00000091(age-2)
Availability: available
Source References: PMID:10219000
Synonyms: age-2(yw23) I; age-1(hx546) II.
Alternate IDs: WB-STRAIN:HG284, CGC_HG284
Notes: This double mutant exhibits a doubling of both mean and maximum lifespans at 25C compared to N2. It exhibits a longer lifespan at 25C than it does at 20C. It has somewhat reduced fertility. It has normal development time, appearance, movements and feeding behavior. It's swimming rate in liquid is slightly higher than N2. STS mapping indicates the most likely location for age-2 is on LG I.
Proper citation: RRID:WB-STRAIN:WBStrain00008402 Copy
http://www.wormbase.org/db/get?name=WBStrain00008404
Source Database: WormBase (WB)
Affected Genes: WBGene00001609(glp-1)
Genomic Alteration: WBGene00001609(glp-1)
Availability: available
Synonyms: glp-1(e2141) III; lynEx1.
Alternate IDs: WB-STRAIN:HGA8002, CGC_HGA8002
Notes: lynEx1 [(pJG01)nhr-80p::nhr-80::GFP + myo-2p::DsRed]. Sterile at 25C. Maintain at 20C or lower. Pick animals with red pharynx to maintain. Lifespan of animals carrying the array is longer than that of glp-1 alone. Reference: Goudeau J, et al. PLoS Biol. 2011 Mar;9(3):e1000599.
Proper citation: RRID:WB-STRAIN:WBStrain00008404 Copy
http://www.wormbase.org/db/get?name=WBStrain00008405
Source Database: WormBase (WB)
Affected Genes: WBGene00001609(glp-1)|WBGene00003670(nhr-80)
Genomic Alteration: WBGene00001609(glp-1), WBGene00003670(nhr-80)
Availability: unknown
Synonyms: glp-1(e2141) nhr-80(tm1011) III; lynEx1.
Alternate IDs: WB-STRAIN:HGA8003
Notes: lynEx1 [(pJG01)nhr-80p::nhr-80::GFP + myo-2p::DsRed]. Sterile at 25C. Maintain at 20C or lower. Pick animals with red pharynx to maintain. lynEx1 fully rescues nhr-80(tm1011). Reference: Goudeau J, et al. PLoS Biol. 2011 Mar;9(3):e1000599.
Proper citation: RRID:WB-STRAIN:WBStrain00008405 Copy
http://www.wormbase.org/db/get?name=WBStrain00008406
Source Database: WormBase (WB)
Affected Genes: WBGene00000912(daf-16)|WBGene00001609(glp-1)
Genomic Alteration: WBGene00000912(daf-16), WBGene00001609(glp-1)
Availability: available
Synonyms: daf-16(mu86) I; glp-1(e2141) III; lynEx1.
Alternate IDs: WB-STRAIN:HGA8004, CGC_HGA8004
Notes: lynEx1 [(pJG01)nhr-80p::nhr-80::GFP + myo-2p::DsRed]. Sterile at 25C. Maintain at 20C or lower. Pick animals with red pharynx to maintain. Lifespan of animals carrying the array is longer than that of daf-16; glp-1 double mutants. Reference: Goudeau J, et al. PLoS Biol. 2011 Mar;9(3):e1000599.
Proper citation: RRID:WB-STRAIN:WBStrain00008406 Copy
http://www.wormbase.org/db/get?name=WBStrain00008407
Source Database: WormBase (WB)
Affected Genes: WBGene00000908(daf-12)|WBGene00001609(glp-1)
Genomic Alteration: WBGene00000908(daf-12), WBGene00001609(glp-1)
Availability: available
Synonyms: glp-1(e2141) III; daf-12(rh61rh411) X; lynEx1.
Alternate IDs: WB-STRAIN:HGA8005, CGC_HGA8005
Notes: lynEx1 [(pJG01)nhr-80p::nhr-80::GFP + myo-2p::DsRed]. Sterile at 25C. Maintain at 20C or lower. Pick animals with red pharynx to maintain. Lifespan of animals carrying the array is longer than that of glp-1; daf-12 double mutants. Reference: Goudeau J, et al. PLoS Biol. 2011 Mar;9(3):e1000599.
Proper citation: RRID:WB-STRAIN:WBStrain00008407 Copy
http://www.wormbase.org/db/get?name=WBStrain00008490
Source Database: WormBase (WB)
Availability: available
Synonyms: osIs1.
Alternate IDs: WB-STRAIN:HS1337, CGC_HS1337
Notes: Mutagen:Gamma ray|"osIs1 [CYE-1::GFP (pMF101) + unc-76(+)]; probably integrated on LG II. This strain has Ste, Emb, Muv, Him phenotypes (probably dominant effects of the integration). Expression in many blast cells can be detected. Reference: Fujita et al. PLoS ONE 2, e407 (2007)."
Proper citation: RRID:WB-STRAIN:WBStrain00008490 Copy
http://www.wormbase.org/db/get?name=WBStrain00008491
Source Database: WormBase (WB)
Availability: available
Synonyms: osIs2.
Alternate IDs: WB-STRAIN:HS1339, CGC_HS1339
Notes: Mutagen:Gamma ray|"osIs2 [CYE-1::GFP (pMF101) + unc-76(+)]; probably integrated on LG X. No dominant phenotypes observed (see HS1337). Expression in many blast cells can be detected, but much weaker than osIs1. Reference: Fujita et al. PLoS ONE 2, e407 (2007)."
Proper citation: RRID:WB-STRAIN:WBStrain00008491 Copy
http://www.wormbase.org/db/get?name=WBStrain00008492
Source Database: WormBase (WB)
Affected Genes: WBGene00006808(unc-76)
Genomic Alteration: WBGene00006808(unc-76)
Availability: available
Synonyms: unc-76(e911) V; osEx233.
Alternate IDs: WB-STRAIN:HS1359, CGC_HS1359
Notes: osEx233 [scm::mig-5::venus + unc-76(+)]. Pick non-Unc to maintain. Reference: Mizumoto K, Sawa H. Dev Cell. 2007 Feb;12(2):287-99.
Proper citation: RRID:WB-STRAIN:WBStrain00008492 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
