Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
DA-Tph2em2Mcwi+/- Resource Report Resource Website |
RRID:RGD_14394620 | Rattus norvegicus | The Tph2em2Mcwi was produced by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 7. | 14394620 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 14394620 | 2026-09-19 01:18:50 | 0 | |||||
|
DA-Tph2em2Mcwi+/+ Resource Report Resource Website |
RRID:RGD_14394619 | Rattus norvegicus | This wild type strain was produced by crossing Tph2em2Mcwi heterozygous rats and confirmed by sequencing. The Tph2em2Mcwi was produced by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 7. | 14394619 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 14394619 | 2026-09-19 01:18:50 | 0 | |||||
|
DA-Tph2em3Mcwi-/- Resource Report Resource Website |
RRID:RGD_14394618 | Rattus norvegicus | This homozygous mutant strain was produced by crossing Tph2em3Mcwi heterozygous rats and confirmed by sequencing. The Tph2em3Mcwi heterozygous mutant was created by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 11-bp frameshift deletion in exon 7. | 14394618 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 14394618 | 2026-09-19 01:18:50 | 0 | |||||
|
SD-Kcnk3em1Ang-/- Resource Report Resource Website |
RRID:RGD_126908010 | Rattus norvegicus | The homozygous Kcnk3 mutant rats are littermates of cross of heterozygotesKcnk3 mutant rats . The mutation created by CRISPR/Cas9 contained a 94- bp deletion in exon1 of resulted a premature stop codon. | 126908010 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 126908010 | 2026-09-19 01:18:50 | 0 | |||||
|
SD-Kcnk3em1Ang-/+ Resource Report Resource Website |
RRID:RGD_126908013 | Rattus norvegicus | The heterozygous Kcnk3 mutant rats were created by CRISPR/Cas9. The mutated allele contained a 94- bp deletion in exon1 of resulted a premature stop codon. | 126908013 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 126908013 | 2026-09-19 01:18:50 | 0 | |||||
|
SD-Wfs1em2Ptsn Resource Report Resource Website |
RRID:RGD_149735336 | Rattus norvegicus | Rat Wfs1 exon 5-specific zinc-finger nucleases (ZNFs) and microinjection-ready mRNA were injected to embryos harvested from female Sprague-Dawley rats (Crl: CD(SD) )rats. Thereafter, microinjected egg cells were transferred to the oviduct of pseudopregnant Sprague-Dawley recipients.Three different Wfs1 mutant rat lines were created: Wfs1em1 ( Wfs1-ex5-KO232), Wfs1em2 (Wfs1-ex5-KO266) and Wfs1em3 (Wfs1-ex5-INS244). Wfs1em2 rats carry a 27 amino acids deletion in exon 5 (aa212-238). | 149735336 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 149735336 | 2026-09-19 01:18:50 | 0 | |||||
|
SD-Bace1em1Sage+/+ Resource Report Resource Website |
RRID:RGD_14394487 | Rattus norvegicus | The Bace1 (+/+) rats were generated by crossing SD-Bace1em1Sage. The mutant rats were generated by SAGE Labs using zinc-finger nuclease (ZFN) technology to create a 137-base pair deletion spanning the translation initiation start site in exon 1 of the rat Bace1 gene, corresponding to chr8:48,766,315-48,766,452 (RGSC 5.0/rn5 assembly) | 14394487 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 14394487 | 2026-09-19 01:18:51 | 0 | |||||
|
SD-Rin1em1-/-Hcz Resource Report Resource Website |
RRID:RGD_126790547 | Rattus norvegicus | This strain was produced by injecting TALEN targeting the sequence of ratRin1 into SD embryos. The resulting mutation is a knock out of the gene. | 126790547 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 126790547 | 2026-09-19 01:18:50 | 0 | |||||
|
SD-Apoa4em1Bcgen Resource Report Resource Website 1+ mentions |
RRID:RGD_150429965 | Rattus norvegicus | TALEN system targeting the rat Apoa4 gene was injected to Sprague Dawley embryos. An 8 bp deletion was induced within the coding region of Apoa4 gene, which results in a frameshift and gene knockout. The genotypes were confirmed by PCR analysis followed by Sanger sequencing and agarose electrophoresis (PCR forward primer: 5′-TATCCCAACTCCAACATCATCCA-3′, reverse primer: 5′-TCGCAGTCTGATCCCACTTACTT-3′). The knockout allele generated a band at 237 bp, while the wild-type allele was at 245 bp. | 150429965 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 150429965 | 2026-09-19 01:18:51 | 1 | |||||
|
SD-Ldlrem1Dlli Resource Report Resource Website |
RRID:RGD_150520185 | Rattus norvegicus | Zygotes of SD rats were microinjected with CRISPR/Cas9 system targeting Ldlr . This mutant possesses a 118-bp deletion from No.22759599bp to 22759716bp in the Ldlr gene (NC_005107.4), resulting in a termination codon TAG, and deletion of 768 amino acids of Ldlr. | 150520185 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 150520185 | 2026-09-19 01:18:50 | 0 | |||||
|
SD-Slco1b2em1Myliu Resource Report Resource Website 1+ mentions |
RRID:RGD_150520221 | Rattus norvegicus | The Sprague Dawley embryos were injected with CRISPR/Case9 system targeting the first exon of the rat Slco1b2 gene. A Slco1b2 knockout was created with 11-bp deletion. | 150520221 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 150520221 | 2026-09-19 01:18:51 | 1 | |||||
|
SD-Apoeem1Ejt Resource Report Resource Website |
RRID:RGD_150520189 | Rattus norvegicus | The mutant rat strain was produced by injecting TALEN system targeting the exon 4 of rat Apoe into Sprague Dawley (Hsd:SD) embryos. This mutant rat has a 16-bp deletion in the gene third coding exon) located on chromosome 1; frameshift mutation resulted (p.Glu178fs) | 150520189 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 150520189 | 2026-09-19 01:18:51 | 0 | |||||
|
SD-Rag2em1Hera Resource Report Resource Website 1+ mentions |
RRID:RGD_38543943 | Rattus norvegicus | The Rag2 gene in rat spermatogonia stem cells (SSC, SD-WT2) was targeted by TALENs and resulted in a 27-bp in-frame deletion. The genome modified SSC was transplanted to Busulfan-treated, Dazl-deficient male Sprague Dawley rats and mated with wild type female Sprague Dawley rats 70 to 81 later. The allele was then bred to homozygosity to generate the Sprague-Dawley Rag2 (SDR)-knockout rat. | 38543943 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 38543943 | 2026-09-19 01:18:50 | 2 | |||||
|
SD-Defb23em2MlitDefb26em2Mlit Resource Report Resource Website |
RRID:RGD_38549356 | Rattus norvegicus | CRISPR/Cas9 system was used to generate this double-gene knockout. The Slc:SD zygotes were injected with sgRNAs that containing 4 sgRNAs (5 ng/ml each) targeting 2 adjacent sites (target sites 1 and 2) of each of the 2 genes. The resulting mutations are 317 bp (Defb23) and 380 bp (Defb26) fragments which were deleted in the Defb23/Defb26 double-mutant strain. | 38549356 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 38549356 | 2026-09-19 01:18:51 | 0 | |||||
|
ACI-Pvt1em4Shul/Rrrc Resource Report Resource Website |
RRID:RGD_150520215 | Rattus norvegicus | CRISPR/Cas9 was used to delete miR1208 in a 763bp excision in ACI rat embryos. This strain is maintained at Rat Resource and Research Center. | 150520215 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 150520215 | 2026-09-19 01:18:51 | 0 | |||||
|
ACI-Pvt1em5Shul Resource Report Resource Website |
RRID:RGD_150520216 | Rattus norvegicus | Using CRISPR/Cas9, a suspected enhancer of miR1208 was deleted in a 8315bp excision in ACI rat embryos. | 150520216 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2021-11-05) | 150520216 | 2026-09-19 01:18:51 | 0 | |||||
|
ACI-Pvt1em5Shul/Rrrc Resource Report Resource Website |
RRID:RGD_150520217 | Rattus norvegicus | Using CRISPR/Cas9, a suspected enhancer of miR1208 was deleted in a 8315bp excision in ACI rat embryos. This strain is maintained at Rat Resource and Research Center. | 150520217 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 150520217 | 2026-09-19 01:18:51 | 0 | |||||
|
SD-Add3em1Mcwi/ Roman Resource Report Resource Website |
RRID:RGD_150429615 | Rattus norvegicus | ZFN system was used to Knock out the rat Add3 gene of Crl:SD rat embryos.The ZFN mRNA was injected into the pronucleus of fertilized SpragueDawley embryos and transferred to the oviduct of pseudopregnant females. PCR genotyping of tail biopsies confirmed a 14-bp deletion using forward primer 5'-GCCCCCATGAGTCACTACAC-3' and reverse primer 5'-GCTACAGGAAGCATCTCCTGTG-3'. Founders with Add3 deletion were backcrossed to the parental strain to generate heterozygous F1 rats. Heterozygous F1 siblings were then intercrossed to derive a homozygous KO line used | 150429615 | mutant | Rat Genome Database (RGD) | RGD | Unknown (as of 2021-09-09) | 150429615 | 2026-09-19 01:18:50 | 0 | |||||
|
BBDR.BBDP-(D4Mit6-D4Mit7)-Tlr4em5Mcwi Resource Report Resource Website |
RRID:RGD_14394508 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a 5-bp deletion in exon2 in the Tlr4 gene of BBDR.BBDP-(D4Mit6-D4Mit7)/RhwMcwi embryos. Contact MCW rat distribution at [email protected] | 14394508 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2019-03-25) | 14394508 | 2026-09-19 01:18:51 | 0 | |||||
|
SHRSP-Stim1em1Izm Resource Report Resource Website |
RRID:RGD_39128170 | Rattus norvegicus | "This strain was generated by co-introducing fertilized eggs of SHRSP/Izm with the guide RNA/Cas9 nuclease expression plasmid and ssODN, which targets the Stim1 gene, at the Institute of Laboratory Animals, Graduate School of Medicine, Kyoto University. SHRSP/Izm strain has a nonsense mutation (c.1918C>T, p.Arg640X) in the Stim1 gene, but homologous recombination with the introduced ssODN replaces this mutation with a normal sequence. The sequence of the guide RNA target site is as follows, Stim1: 5'-GCAGGGTAGCTGAAACACAC-3' The sequence of the ssODN for homologous recombination is as follows, 5'-ATAGCCTTCTTGCCAGCCAAGTGGGGAATTCGTGTGTTTCGGCTACCCTGCAGGGCTCGGCTGTCCCCAACTGGAGATGGCCATCTCCAGTTGGGGACAGCCGAGCCCTGCAGGGTAGCCGAAACACACGAATTCCCCACTTGGCTGGCAAGAAGGCTAT-3'" National BioResource Project for the Rat in Japan | 39128170 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2020-09-23) | 39128170 | 2026-09-19 01:18:51 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.