Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Availability:extinct (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

64 Results - per page

Show More Columns | Download 64 Result(s)

Organism Name Proper Citation Species Synonyms Notes Phenotype Affected Gene Genomic Alteration Catalog Number Background Database Database Abbreviation Availability Source References Alternate IDs Record Last Update Mentions Count
SS-Apoeem7Mcwi
 
Resource Report
Resource Website
RRID:RGD_5131921 Rattus norvegicus This strain was produced by injecting ZFNs targeting the sequence CAGGCCCTGAACCGCttctggGATTACCTGCGCTGGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 15-bp frameshift deletion in exon 2. 5131921 mutant Rat Genome Database (RGD) RGD Extinct 5131921 2026-08-01 12:40:28 0
BUF/N
 
Resource Report
Resource Website
RRID:RGD_60986 Rattus norvegicus Heston 1946 from Buffalo stock of H. Morris. To NIH in 1950 at F10. NIH Autoimmune Rat Model Repository and Development Center 60986 inbred Rat Genome Database (RGD) RGD Extinct 60986 2026-08-01 12:40:03 0
MHS/N
 
Resource Report
Resource Website
RRID:RGD_60987 Rattus norvegicus Milan Hypertensive Strain: Outbred Wistar rats with brother x sister mating and selection for high systolic blood pressure (Bianchi et al 1974, Barber et al, 1994). 60987 inbred Rat Genome Database (RGD) RGD Extinct 60987 2026-08-01 12:40:03 0
BB/N
 
Resource Report
Resource Website
RRID:RGD_61011 Rattus norvegicus Mutation causing diabetes mellitus in a closed colony of outbred Wistar rats at Bio-Breeding Labs, Ontario, Canada in 1974 (Chappel and Chappel 1983). To Worcester in 1977 where inbreeding began. Sublines of diabetic-prone and diabetic-resistant animals have been developed, and there are also subline differences in the incidence, age of onset, untreated survival time of diabetes, leucopenia and body weight gain which can be attributed to genetic factors (Kloting et al 1987). A detailed study of 24 inbred and two outbred lines of diabetes-prone and diabetes resistant BB rats using eight marker loci found substantial genetic variation among and some variation within some of the colonies. The 22 colonies which were apparently isogenic could be divided into four groups on the basis of the marker loci (Prins et al 1990). 61011 inbred Rat Genome Database (RGD) RGD Extinct 61011 2026-08-01 12:40:03 0
MNR/N
 
Resource Report
Resource Website
RRID:RGD_10026 Rattus norvegicus To N 1964 at F18+? from Maas. Developed by Broadhurst, 1954, from a commercial stock, with selection for low defecation response in an open field. A number of parallel sublines are in existence; these differ at least at the agouti and the major histocompatibility loci. 10026 inbred Rat Genome Database (RGD) RGD Extinct 10026 2026-08-01 12:40:03 0
KGH/PitN
 
Resource Report
Resource Website
RRID:RGD_68058 Rattus norvegicus Kunz and Gill from outbred NEDH rats supplied by the Animal Research Center, Harvard University (Kunz and Gill 1974, Kunz et al 1974). 68058 inbred Rat Genome Database (RGD) RGD Extinct 68058 2026-08-01 12:40:05 0
PSDO/N
 
Resource Report
Resource Website
RRID:RGD_68119 Rattus norvegicus Reserved symbol for strain in development now at F6 (NIH 1989). 68119 inbred Rat Genome Database (RGD) RGD Extinct 68119 2026-08-01 12:40:06 0
A28807/N
 
Resource Report
Resource Website
RRID:RGD_70417 Rattus norvegicus Curtis and Dunning in 1936 as a subline of A7322 derived from a half-brother x sister mating at F15. To NIH in 1977 at F25 (Hansen et al 1982). 70417 inbred Rat Genome Database (RGD) RGD Extinct 70417 2026-08-01 12:40:08 0
N:NIH
 
Resource Report
Resource Website
RRID:RGD_728185 Rattus norvegicus Developed in 1979/80 from a series involving eight inbred strains of rats (BN/SsN, MAIN, BuF/N, M520/N, WN/N, ACI/N, WKY IN, and F344/N). The resulting colony consists of 60 breeding pairs. A circular pair mating system is used to maintain the colony. 728185 outbred Rat Genome Database (RGD) RGD Extinct 728185 2026-08-01 12:40:08 0
LOU/CN
 
Resource Report
Resource Website
RRID:RGD_728191 Rattus norvegicus To N in 1976 from Bazin at F?. In 1970 Bazin and Beckers started breeding LOU rat ancestors from various stocks kept at Universite Catholique de Louvain (probably of Wis- tar origin); from 28 lines bred in parallel, LOU/C was selected for high immunocytoma incidence and LOU/M for low immunocytoma incidence. (045) 728191 inbred Rat Genome Database (RGD) RGD Extinct 728191 2026-08-01 12:40:07 0
N:SD Sprague-Dawley
 
Resource Report
Resource Website
10+ mentions
RRID:RRRC_00239 Rattus norvegicus To N 1945 from Sprague Dawley, Inc. Colony closed since then. NIH Autoimmune Rat Model Repository and Development Center, Rat Resource and Research Center 00239 outbred Rat Resource and Research Center (RRRC) RRRC Extinct RGD_728193, 728193, RRRC_239, RRRC_0239, RRRC_00239 2026-08-01 03:02:17 17
SS-Nckap5em1Mcwi
 
Resource Report
Resource Website
RRID:RGD_4139879 Rattus norvegicus This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 6. 4139879 mutant Rat Genome Database (RGD) RGD Extinct 4139879 2026-08-01 12:40:27 0
SS-Mylipem3Mcwi
 
Resource Report
Resource Website
RRID:RGD_5508371 Rattus norvegicus This strain was produced by injecting ZFNs targeting the sequence GCCCCAGCCATGCTGTGCtatgtGACGAGGCCGGACGCGGTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 51-bp frameshift deletion in exon 1. 5508371 mutant Rat Genome Database (RGD) RGD Extinct 5508371 2026-08-01 12:40:31 0
SS.BN-(D13Rat20-D13Got22)/Mcwi-Nckap5em4Mcwi
 
Resource Report
Resource Website
RRID:RGD_5509997 Rattus norvegicus This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS.BN-(D13Rat20-D13Got22)/Mcwi rat embryos. The resulting mutation is an 11-bp frameshift deletion in exon 6. 5509997 mutant Rat Genome Database (RGD) RGD Extinct 5509997 2026-08-01 12:40:30 0
SS-Chr 5BN-Cyp4a2em1Mcwi
 
Resource Report
Resource Website
RRID:RGD_5687974 Rattus norvegicus This strain was produced by injecting ZFNs targeting the sequence CTGCTCTATGACCCTGACTatgtgAAGGTGGTTCTGGGAAGAT into SS-Chr 5BN/Mcwi strain rat embryos. The resulting mutation is a 2-bp framesnift deletion in exon 2. 5687974 mutant Rat Genome Database (RGD) RGD Extinct 5687974 2026-08-01 12:40:30 0
SS-Apoeem8Mcwi+/+
 
Resource Report
Resource Website
RRID:RGD_5687992 Rattus norvegicus ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5687992 mutant Rat Genome Database (RGD) RGD Extinct 5687992 2026-08-01 12:40:31 0
SS-Apoeem7Mcwi-/-
 
Resource Report
Resource Website
RRID:RGD_5687987 Rattus norvegicus ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5687987 mutant Rat Genome Database (RGD) RGD Extinct 5687987 2026-08-01 12:40:31 0
SS-Chr 5BN-Cyp4a2em1Mcwi-/+
 
Resource Report
Resource Website
RRID:RGD_5688006 Rattus norvegicus ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688006 mutant Rat Genome Database (RGD) RGD Extinct 5688006 2026-08-01 12:40:31 0
SS-Chr 5BN-Cyp4a2em1Mcwi+/+
 
Resource Report
Resource Website
RRID:RGD_5688002 Rattus norvegicus ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688002 mutant Rat Genome Database (RGD) RGD Extinct 5688002 2026-08-01 12:40:31 0
BBDR.BBDP-(D4Mit6-D4Mit7)/RhwMcwi-Il1r1em1Mcwi
 
Resource Report
Resource Website
RRID:RGD_6893437 Rattus norvegicus This strain was produced by injecting ZFNs targeting the sequence AGCTTCATACAGCGGCtccatgTTGCAGGGGATGGAAGTC into BBDR.BBDP-(D4Mit6-D4Mit7)/RhwMcwi rat embryos. The resulting mutation is a 13-bp deletion in exon 5. 6893437 mutant Rat Genome Database (RGD) RGD Extinct 6893437 2026-08-01 12:40:33 0

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.