Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
SS-Apoeem7Mcwi Resource Report Resource Website |
RRID:RGD_5131921 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence CAGGCCCTGAACCGCttctggGATTACCTGCGCTGGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 15-bp frameshift deletion in exon 2. | 5131921 | mutant | Rat Genome Database (RGD) | RGD | Extinct | 5131921 | 2026-08-01 12:40:28 | 0 | |||||
|
BUF/N Resource Report Resource Website |
RRID:RGD_60986 | Rattus norvegicus | Heston 1946 from Buffalo stock of H. Morris. To NIH in 1950 at F10. NIH Autoimmune Rat Model Repository and Development Center | 60986 | inbred | Rat Genome Database (RGD) | RGD | Extinct | 60986 | 2026-08-01 12:40:03 | 0 | |||||
|
MHS/N Resource Report Resource Website |
RRID:RGD_60987 | Rattus norvegicus | Milan Hypertensive Strain: Outbred Wistar rats with brother x sister mating and selection for high systolic blood pressure (Bianchi et al 1974, Barber et al, 1994). | 60987 | inbred | Rat Genome Database (RGD) | RGD | Extinct | 60987 | 2026-08-01 12:40:03 | 0 | |||||
|
BB/N Resource Report Resource Website |
RRID:RGD_61011 | Rattus norvegicus | Mutation causing diabetes mellitus in a closed colony of outbred Wistar rats at Bio-Breeding Labs, Ontario, Canada in 1974 (Chappel and Chappel 1983). To Worcester in 1977 where inbreeding began. Sublines of diabetic-prone and diabetic-resistant animals have been developed, and there are also subline differences in the incidence, age of onset, untreated survival time of diabetes, leucopenia and body weight gain which can be attributed to genetic factors (Kloting et al 1987). A detailed study of 24 inbred and two outbred lines of diabetes-prone and diabetes resistant BB rats using eight marker loci found substantial genetic variation among and some variation within some of the colonies. The 22 colonies which were apparently isogenic could be divided into four groups on the basis of the marker loci (Prins et al 1990). | 61011 | inbred | Rat Genome Database (RGD) | RGD | Extinct | 61011 | 2026-08-01 12:40:03 | 0 | |||||
|
MNR/N Resource Report Resource Website |
RRID:RGD_10026 | Rattus norvegicus | To N 1964 at F18+? from Maas. Developed by Broadhurst, 1954, from a commercial stock, with selection for low defecation response in an open field. A number of parallel sublines are in existence; these differ at least at the agouti and the major histocompatibility loci. | 10026 | inbred | Rat Genome Database (RGD) | RGD | Extinct | 10026 | 2026-08-01 12:40:03 | 0 | |||||
|
KGH/PitN Resource Report Resource Website |
RRID:RGD_68058 | Rattus norvegicus | Kunz and Gill from outbred NEDH rats supplied by the Animal Research Center, Harvard University (Kunz and Gill 1974, Kunz et al 1974). | 68058 | inbred | Rat Genome Database (RGD) | RGD | Extinct | 68058 | 2026-08-01 12:40:05 | 0 | |||||
|
PSDO/N Resource Report Resource Website |
RRID:RGD_68119 | Rattus norvegicus | Reserved symbol for strain in development now at F6 (NIH 1989). | 68119 | inbred | Rat Genome Database (RGD) | RGD | Extinct | 68119 | 2026-08-01 12:40:06 | 0 | |||||
|
A28807/N Resource Report Resource Website |
RRID:RGD_70417 | Rattus norvegicus | Curtis and Dunning in 1936 as a subline of A7322 derived from a half-brother x sister mating at F15. To NIH in 1977 at F25 (Hansen et al 1982). | 70417 | inbred | Rat Genome Database (RGD) | RGD | Extinct | 70417 | 2026-08-01 12:40:08 | 0 | |||||
|
N:NIH Resource Report Resource Website |
RRID:RGD_728185 | Rattus norvegicus | Developed in 1979/80 from a series involving eight inbred strains of rats (BN/SsN, MAIN, BuF/N, M520/N, WN/N, ACI/N, WKY IN, and F344/N). The resulting colony consists of 60 breeding pairs. A circular pair mating system is used to maintain the colony. | 728185 | outbred | Rat Genome Database (RGD) | RGD | Extinct | 728185 | 2026-08-01 12:40:08 | 0 | |||||
|
LOU/CN Resource Report Resource Website |
RRID:RGD_728191 | Rattus norvegicus | To N in 1976 from Bazin at F?. In 1970 Bazin and Beckers started breeding LOU rat ancestors from various stocks kept at Universite Catholique de Louvain (probably of Wis- tar origin); from 28 lines bred in parallel, LOU/C was selected for high immunocytoma incidence and LOU/M for low immunocytoma incidence. (045) | 728191 | inbred | Rat Genome Database (RGD) | RGD | Extinct | 728191 | 2026-08-01 12:40:07 | 0 | |||||
|
N:SD Sprague-Dawley Resource Report Resource Website 10+ mentions |
RRID:RRRC_00239 | Rattus norvegicus | To N 1945 from Sprague Dawley, Inc. Colony closed since then. NIH Autoimmune Rat Model Repository and Development Center, Rat Resource and Research Center | 00239 | outbred | Rat Resource and Research Center (RRRC) | RRRC | Extinct | RGD_728193, 728193, RRRC_239, RRRC_0239, RRRC_00239 | 2026-08-01 03:02:17 | 17 | |||||
|
SS-Nckap5em1Mcwi Resource Report Resource Website |
RRID:RGD_4139879 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 6. | 4139879 | mutant | Rat Genome Database (RGD) | RGD | Extinct | 4139879 | 2026-08-01 12:40:27 | 0 | |||||
|
SS-Mylipem3Mcwi Resource Report Resource Website |
RRID:RGD_5508371 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence GCCCCAGCCATGCTGTGCtatgtGACGAGGCCGGACGCGGTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 51-bp frameshift deletion in exon 1. | 5508371 | mutant | Rat Genome Database (RGD) | RGD | Extinct | 5508371 | 2026-08-01 12:40:31 | 0 | |||||
|
SS.BN-(D13Rat20-D13Got22)/Mcwi-Nckap5em4Mcwi Resource Report Resource Website |
RRID:RGD_5509997 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS.BN-(D13Rat20-D13Got22)/Mcwi rat embryos. The resulting mutation is an 11-bp frameshift deletion in exon 6. | 5509997 | mutant | Rat Genome Database (RGD) | RGD | Extinct | 5509997 | 2026-08-01 12:40:30 | 0 | |||||
|
SS-Chr 5BN-Cyp4a2em1Mcwi Resource Report Resource Website |
RRID:RGD_5687974 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence CTGCTCTATGACCCTGACTatgtgAAGGTGGTTCTGGGAAGAT into SS-Chr 5BN/Mcwi strain rat embryos. The resulting mutation is a 2-bp framesnift deletion in exon 2. | 5687974 | mutant | Rat Genome Database (RGD) | RGD | Extinct | 5687974 | 2026-08-01 12:40:30 | 0 | |||||
|
SS-Apoeem8Mcwi+/+ Resource Report Resource Website |
RRID:RGD_5687992 | Rattus norvegicus | ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. | 5687992 | mutant | Rat Genome Database (RGD) | RGD | Extinct | 5687992 | 2026-08-01 12:40:31 | 0 | |||||
|
SS-Apoeem7Mcwi-/- Resource Report Resource Website |
RRID:RGD_5687987 | Rattus norvegicus | ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. | 5687987 | mutant | Rat Genome Database (RGD) | RGD | Extinct | 5687987 | 2026-08-01 12:40:31 | 0 | |||||
|
SS-Chr 5BN-Cyp4a2em1Mcwi-/+ Resource Report Resource Website |
RRID:RGD_5688006 | Rattus norvegicus | ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. | 5688006 | mutant | Rat Genome Database (RGD) | RGD | Extinct | 5688006 | 2026-08-01 12:40:31 | 0 | |||||
|
SS-Chr 5BN-Cyp4a2em1Mcwi+/+ Resource Report Resource Website |
RRID:RGD_5688002 | Rattus norvegicus | ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. | 5688002 | mutant | Rat Genome Database (RGD) | RGD | Extinct | 5688002 | 2026-08-01 12:40:31 | 0 | |||||
|
BBDR.BBDP-(D4Mit6-D4Mit7)/RhwMcwi-Il1r1em1Mcwi Resource Report Resource Website |
RRID:RGD_6893437 | Rattus norvegicus | This strain was produced by injecting ZFNs targeting the sequence AGCTTCATACAGCGGCtccatgTTGCAGGGGATGGAAGTC into BBDR.BBDP-(D4Mit6-D4Mit7)/RhwMcwi rat embryos. The resulting mutation is a 13-bp deletion in exon 5. | 6893437 | mutant | Rat Genome Database (RGD) | RGD | Extinct | 6893437 | 2026-08-01 12:40:33 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.