Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Database:WB (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

64,152 Results - per page

Show More Columns | Download Top 1000 Results

Organism Name Proper Citation Species Synonyms Notes Phenotype Affected Gene Genomic Alteration Catalog Number Background Database Database Abbreviation Availability Source References Alternate IDs Record Last Update Mentions Count
MT15107
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00027516 Caenorhabditis elegans lin-53(n3368) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Homozygous lethal deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP n3368 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.Class B SynMuv, Ste, Pvul. Reference: Harrison MM, Ceol CJ, Lu X, Horvitz HR. PNAS. 2006 Nov 7;103(45):16782-7.|"Mutagen:UV/TMP" WBGene00000254(bli-4)|WBGene00003036(lin-53) WBGene00000254(bli-4), WBGene00003036(lin-53) WB-STRAIN:WBStrain00027516 WormBase (WB) WB available PMID:31397537 WB-STRAIN:MT15107, CGC_MT15107 2026-09-12 11:15:31 1
MT19110
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00027597 Caenorhabditis elegans nIs363 X. Mutagen:Gamma radiation|"nIs363 [D2096.6 (1.7kb UP)::4xNLS-GFP] X. Reference: Nakano S, et al. Development. 2010 Dec;137(23):4017-27"|"nIs363 [D2096.6 (1.7kb UP)::pes-10::4xNLS::GFP + lin-15AB(+)]. Reference: Nakano S, et al. Development. 2010 Dec;137(23):4017-27 [NOTE (Aug 2019): the nIs363 trasngene in this strain was previously described as nIs363 [D2096.6 (1.7kb UP)::4xNLS-GFP] X.]" WB-STRAIN:WBStrain00027597 WormBase (WB) WB available WB-STRAIN:MT19110, CGC_MT19110 2026-09-12 11:15:32 0
MT19372
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00027599 Caenorhabditis elegans sptf-3(n4850) I; nIs283 X. nIs283 [gcy-10p::4xNLS::GFP + lin-15(+)]. gcy-10p::4xNLS::GFP is expressed in I1 neurons. Reference: Hirose T, Horvitz HR. Nature. 2013 Aug 15; 500(7462): 354-358.|"nIs283 [gcy-10p::GFP + lin-15(+)]. Reference: Hirose T, Horvitz HR. Nature. 2013 Aug 15; 500(7462): 354-358." WBGene00012735(sptf-3) WBGene00012735(sptf-3) WB-STRAIN:WBStrain00027599 WormBase (WB) WB available WB-STRAIN:MT19372, CGC_MT19372 2026-09-12 11:15:32 0
MT15081
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00027512 Caenorhabditis elegans sup-17(n1315) unc-29(e1072) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Heterozygotes are WT and GFP+. hT2[qIs48] animals are recessive lethal. n1315 is recessive lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. WBGene00000254(bli-4)|WBGene00006324(sup-17)|WBGene00006765(unc-29) WBGene00000254(bli-4), WBGene00006324(sup-17), WBGene00006765(unc-29) WB-STRAIN:WBStrain00027512 WormBase (WB) WB available WB-STRAIN:MT15081, CGC_MT15081 2026-09-12 11:15:31 0
MT18410
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00027593 Caenorhabditis elegans mir-58.1(n4640) IV; nDf54 X. Made_by: Ezequiel Alvarez-Saa|"Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73." WBGene00003286(mir-58.1) WBGene00003286(mir-58.1) WB-STRAIN:WBStrain00027593 WormBase (WB) WB available WB-STRAIN:MT18410, CGC_MT18410 2026-09-12 11:15:32 0
MT18690
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00027594 Caenorhabditis elegans sfa-1(n5223) IV/nT1 [qIs51] (IV;V). Maintain under normal condition. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP sfa-1 homozygotes (arrest L1-L2 stage). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Ma & Horvitz (2009) PLoS 5(11):e1000708. WBGene00013808(sfa-1) WBGene00013808(sfa-1) WB-STRAIN:WBStrain00027594 WormBase (WB) WB available WB-STRAIN:MT18690, CGC_MT18690 2026-09-12 11:15:32 0
MT18145
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00027591 Caenorhabditis elegans nIs289 X. Mutagen:Gamma radiation|"nIs289 [mir-71(+) + sur-5::GFP] X. Rescues mir-71(n4115) lifespan defect. Reference: Boulias K, Horvitz HR. Cell Metab. 2012 Apr 4;15(4):439-50." WB-STRAIN:WBStrain00027591 WormBase (WB) WB available WB-STRAIN:MT18145, CGC_MT18145 2026-09-12 11:15:32 0
MT18409
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00027592 Caenorhabditis elegans nDf53 III; mir-58.1(n4640) IV. Made_by: Ezequiel Alvarez-Saa|"Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73." WBGene00003286(mir-58.1) WBGene00003286(mir-58.1) WB-STRAIN:WBStrain00027592 WormBase (WB) WB available WB-STRAIN:MT18409, CGC_MT18409 2026-09-12 11:15:32 0
MT15022
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00027506 Caenorhabditis elegans mir-83(n4638) IV. Deletion breakpoints are:GTTGAGAATTCCTGTTGCAAT / TAAAACTGAAATTTCGATCTA...TTTTTAGAATTGAGAGCA / ACGAAAGAACAAAATAAGAGA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:GTTGAGAATTCCTGTTGCAAT / TAAAACTGAAATTTCGATCTA...TTTTTAGAATTGAGAGCA / ACGAAAGAACAAAATAAGAGA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab" WBGene00003311(mir-83) WBGene00003311(mir-83) WB-STRAIN:WBStrain00027506 WormBase (WB) WB available WB-STRAIN:MT15022, CGC_MT15022 2026-09-12 11:15:31 0
MT15025
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00027509 Caenorhabditis elegans mir-269(n4641) IV. Deletion breakpoints are:CCGTTTGCGAGTCGCGGT / GTTGCTCATTGTGCCCGAT...TCCAACTTCTGAC / CCAAGTCAATATTTTTCAGG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:CCGTTTGCGAGTCGCGGT / GTTGCTCATTGTGCCCGAT...TCCAACTTCTGAC / CCAAGTCAATATTTTTCAGG.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"|"Mutagen:UV/TMP" WBGene00003362(mir-269) WBGene00003362(mir-269) WB-STRAIN:WBStrain00027509 WormBase (WB) WB available WB-STRAIN:MT15025, CGC_MT15025 2026-09-12 11:15:31 0
MT15019
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00027503 Caenorhabditis elegans nDf60 V. Made_by: Horvitz Lab|"mir-357 and mir358 are deleted in this strain. Deletion breakpoints are:TTCTGTTTGACGATGATG / GGGACGATTCAACGGTCA...CATTTAATGTATTTCACAT / CTTTTTGGGTTACTGTAGTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"mir-357 and mir358 are deleted in this strain. Deletion breakpoints are:TTCTGTTTGACGATGATG / GGGACGATTCAACGGTCA...CATTTAATGTATTTCACAT / CTTTTTGGGTTACTGTAGTT.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Mutagen:UV/TMP" WB-STRAIN:WBStrain00027503 WormBase (WB) WB available PMID:38594249 WB-STRAIN:MT15019, CGC_MT15019 2026-09-12 11:15:31 0
MT15020
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00027504 Caenorhabditis elegans mir-246(n4636) IV. Deletion breakpoints are:GATACATCGGTGCAATGAAGA / CATCATCAGATAATATTCTCAA...ATGTTTCGGGTAGGAGCTGT / TCAAACTTTGGACATTGGCATC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:GATACATCGGTGCAATGAAGA / CATCATCAGATAATATTCTCAA...ATGTTTCGGGTAGGAGCTGT / TCAAACTTTGGACATTGGCATC.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab" WBGene00003340(mir-246) WBGene00003340(mir-246) WB-STRAIN:WBStrain00027504 WormBase (WB) WB available PMID:31307392 WB-STRAIN:MT15020, CGC_MT15020 2026-09-12 11:15:31 0
MT15021
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00027505 Caenorhabditis elegans mir-78(n4637) IV. Deletion breakpoints are:CTTTCATACATCTATTTT / ATACGGAAATGTAAAAT...CTTGTTTCAAGCTATCC / ATTTTGCAACAATACTGT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:CTTTCATACATCTATTTT / ATACGGAAATGTAAAAT...CTTGTTTCAAGCTATCC / ATTTTGCAACAATACTGT.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"|"Mutagen:UV/TMP" WBGene00003306(mir-78) WBGene00003306(mir-78) WB-STRAIN:WBStrain00027505 WormBase (WB) WB available WB-STRAIN:MT15021, CGC_MT15021 2026-09-12 11:15:31 2
MT18023
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00027586 Caenorhabditis elegans lin-4(e912) II; mir-237(n4296) X. Made_by: Ezequiel Alvarez-Saa|"Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73." WBGene00002993(lin-4)|WBGene00003330(mir-237) WBGene00002993(lin-4), WBGene00003330(mir-237) WB-STRAIN:WBStrain00027586 WormBase (WB) WB available WB-STRAIN:MT18023, CGC_MT18023 2026-09-12 11:15:32 0
MT18043
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00027588 Caenorhabditis elegans mir-240&mir-786(n4541) X. Deletion breakpoints are: TTGTTGGAGAAATGAATAAA / TGGAACAAAATTAAGAATA...AATGTTTATTATGTTGCAAG / TCTACAAAATTAGGGAACA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Made_by: Horvitz Lab Members" WBGene00003334(mir-240)|WBGene00045343(mir-786) WBGene00003334(mir-240), WBGene00045343(mir-786) WB-STRAIN:WBStrain00027588 WormBase (WB) WB available WB-STRAIN:MT18043, CGC_MT18043 2026-09-12 11:15:32 1
MY10
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00027656 Caenorhabditis elegans EMPTY Natural isolate; obtained in July 2002 from compost heap in Roxel, Mnster, North-West Germany; frozen within 5 generations after isolation; microsatellite genotype EU3.|"WBStrain provided so WBPaper00061063 paper added based on AFP_Strain data."|"Wild-type natural isolate" WB-STRAIN:WBStrain00027656 WormBase (WB) WB available PMID:22301316
PMID:30078564
PMID:33593818
PMID:33820969
PMID:38547054
PMID:38564369
WB-STRAIN:MY10, CGC_MY10 2026-09-12 11:15:33 0
MY4
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00027650 Caenorhabditis elegans Caenorhabditis elegans wild isolate. Natural isolate; obtained in July 2002 from compost heap in Roxel, Mnster, North-West Germany; frozen within 5 generations after isolation; microsatellite genotype EU3. WB-STRAIN:WBStrain00027650 WormBase (WB) WB available WB-STRAIN:MY4, CGC_MY4 2026-09-12 11:15:33 0
MY3
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00027649 Caenorhabditis elegans Caenorhabditis elegans wild isolate. Natural isolate; obtained in July 2002 from compost heap in Roxel, Mnster, North-West Germany; frozen within 5 generations after isolation; microsatellite genotype EU3.|"WBStrain mapped, WBPaper00061409 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061527 added based on AFP_Strain data." WB-STRAIN:WBStrain00027649 WormBase (WB) WB available WB-STRAIN:MY3, CGC_MY3 2026-09-12 11:15:33 0
MX124
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00027645 Caenorhabditis elegans ifta-1(nx61) X. Homozygous viable with no obvious morphological, locomotory, or behavioral phenotypes. However, these animals display cilia-related chemosensory (Che) defective and dye-fill (Dyf) defective phenotypes. 2009 bp deletion with flanking sequences of GATAAGAGGAAATCTTTTTGGAGAGTTGGA and ATTTAGTTTTTCACAAAGAACACCGCAATA. WBGene00016935(ifta-1) WBGene00016935(ifta-1) WB-STRAIN:WBStrain00027645 WormBase (WB) WB available PMID:38302462 WB-STRAIN:MX124, CGC_MX124 2026-09-12 11:15:33 1
MY1
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00027647 Caenorhabditis elegans wild Natural isolate; obtained in April 2002 from compost heap in Lingen, Emsland, North-West Germany; frozen within 5 generations after isolation; microsatellite genotype EU1. WB-STRAIN:WBStrain00027647 WormBase (WB) WB available PMID:22301316
PMID:31422888
PMID:33820969
PMID:34622777
PMID:38564369
PMID:38865452
WB-STRAIN:MY1, CGC_MY1 2026-09-12 11:15:33 2

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.