Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MT15107 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00027516 | Caenorhabditis elegans | lin-53(n3368) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | Homozygous lethal deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP n3368 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.Class B SynMuv, Ste, Pvul. Reference: Harrison MM, Ceol CJ, Lu X, Horvitz HR. PNAS. 2006 Nov 7;103(45):16782-7.|"Mutagen:UV/TMP" | WBGene00000254(bli-4)|WBGene00003036(lin-53) | WBGene00000254(bli-4), WBGene00003036(lin-53) | WB-STRAIN:WBStrain00027516 | WormBase (WB) | WB | available | PMID:31397537 | WB-STRAIN:MT15107, CGC_MT15107 | 2026-09-12 11:15:31 | 1 | ||
|
MT19110 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027597 | Caenorhabditis elegans | nIs363 X. | Mutagen:Gamma radiation|"nIs363 [D2096.6 (1.7kb UP)::4xNLS-GFP] X. Reference: Nakano S, et al. Development. 2010 Dec;137(23):4017-27"|"nIs363 [D2096.6 (1.7kb UP)::pes-10::4xNLS::GFP + lin-15AB(+)]. Reference: Nakano S, et al. Development. 2010 Dec;137(23):4017-27 [NOTE (Aug 2019): the nIs363 trasngene in this strain was previously described as nIs363 [D2096.6 (1.7kb UP)::4xNLS-GFP] X.]" | WB-STRAIN:WBStrain00027597 | WormBase (WB) | WB | available | WB-STRAIN:MT19110, CGC_MT19110 | 2026-09-12 11:15:32 | 0 | |||||
|
MT19372 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027599 | Caenorhabditis elegans | sptf-3(n4850) I; nIs283 X. | nIs283 [gcy-10p::4xNLS::GFP + lin-15(+)]. gcy-10p::4xNLS::GFP is expressed in I1 neurons. Reference: Hirose T, Horvitz HR. Nature. 2013 Aug 15; 500(7462): 354-358.|"nIs283 [gcy-10p::GFP + lin-15(+)]. Reference: Hirose T, Horvitz HR. Nature. 2013 Aug 15; 500(7462): 354-358." | WBGene00012735(sptf-3) | WBGene00012735(sptf-3) | WB-STRAIN:WBStrain00027599 | WormBase (WB) | WB | available | WB-STRAIN:MT19372, CGC_MT19372 | 2026-09-12 11:15:32 | 0 | |||
|
MT15081 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027512 | Caenorhabditis elegans | sup-17(n1315) unc-29(e1072) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). | Heterozygotes are WT and GFP+. hT2[qIs48] animals are recessive lethal. n1315 is recessive lethal. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. | WBGene00000254(bli-4)|WBGene00006324(sup-17)|WBGene00006765(unc-29) | WBGene00000254(bli-4), WBGene00006324(sup-17), WBGene00006765(unc-29) | WB-STRAIN:WBStrain00027512 | WormBase (WB) | WB | available | WB-STRAIN:MT15081, CGC_MT15081 | 2026-09-12 11:15:31 | 0 | |||
|
MT18410 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027593 | Caenorhabditis elegans | mir-58.1(n4640) IV; nDf54 X. | Made_by: Ezequiel Alvarez-Saa|"Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73." | WBGene00003286(mir-58.1) | WBGene00003286(mir-58.1) | WB-STRAIN:WBStrain00027593 | WormBase (WB) | WB | available | WB-STRAIN:MT18410, CGC_MT18410 | 2026-09-12 11:15:32 | 0 | |||
|
MT18690 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027594 | Caenorhabditis elegans | sfa-1(n5223) IV/nT1 [qIs51] (IV;V). | Maintain under normal condition. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP sfa-1 homozygotes (arrest L1-L2 stage). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Ma & Horvitz (2009) PLoS 5(11):e1000708. | WBGene00013808(sfa-1) | WBGene00013808(sfa-1) | WB-STRAIN:WBStrain00027594 | WormBase (WB) | WB | available | WB-STRAIN:MT18690, CGC_MT18690 | 2026-09-12 11:15:32 | 0 | |||
|
MT18145 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027591 | Caenorhabditis elegans | nIs289 X. | Mutagen:Gamma radiation|"nIs289 [mir-71(+) + sur-5::GFP] X. Rescues mir-71(n4115) lifespan defect. Reference: Boulias K, Horvitz HR. Cell Metab. 2012 Apr 4;15(4):439-50." | WB-STRAIN:WBStrain00027591 | WormBase (WB) | WB | available | WB-STRAIN:MT18145, CGC_MT18145 | 2026-09-12 11:15:32 | 0 | |||||
|
MT18409 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027592 | Caenorhabditis elegans | nDf53 III; mir-58.1(n4640) IV. | Made_by: Ezequiel Alvarez-Saa|"Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73." | WBGene00003286(mir-58.1) | WBGene00003286(mir-58.1) | WB-STRAIN:WBStrain00027592 | WormBase (WB) | WB | available | WB-STRAIN:MT18409, CGC_MT18409 | 2026-09-12 11:15:32 | 0 | |||
|
MT15022 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027506 | Caenorhabditis elegans | mir-83(n4638) IV. | Deletion breakpoints are:GTTGAGAATTCCTGTTGCAAT / TAAAACTGAAATTTCGATCTA...TTTTTAGAATTGAGAGCA / ACGAAAGAACAAAATAAGAGA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:GTTGAGAATTCCTGTTGCAAT / TAAAACTGAAATTTCGATCTA...TTTTTAGAATTGAGAGCA / ACGAAAGAACAAAATAAGAGA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab" | WBGene00003311(mir-83) | WBGene00003311(mir-83) | WB-STRAIN:WBStrain00027506 | WormBase (WB) | WB | available | WB-STRAIN:MT15022, CGC_MT15022 | 2026-09-12 11:15:31 | 0 | |||
|
MT15025 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027509 | Caenorhabditis elegans | mir-269(n4641) IV. | Deletion breakpoints are:CCGTTTGCGAGTCGCGGT / GTTGCTCATTGTGCCCGAT...TCCAACTTCTGAC / CCAAGTCAATATTTTTCAGG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:CCGTTTGCGAGTCGCGGT / GTTGCTCATTGTGCCCGAT...TCCAACTTCTGAC / CCAAGTCAATATTTTTCAGG.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"|"Mutagen:UV/TMP" | WBGene00003362(mir-269) | WBGene00003362(mir-269) | WB-STRAIN:WBStrain00027509 | WormBase (WB) | WB | available | WB-STRAIN:MT15025, CGC_MT15025 | 2026-09-12 11:15:31 | 0 | |||
|
MT15019 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027503 | Caenorhabditis elegans | nDf60 V. | Made_by: Horvitz Lab|"mir-357 and mir358 are deleted in this strain. Deletion breakpoints are:TTCTGTTTGACGATGATG / GGGACGATTCAACGGTCA...CATTTAATGTATTTCACAT / CTTTTTGGGTTACTGTAGTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"mir-357 and mir358 are deleted in this strain. Deletion breakpoints are:TTCTGTTTGACGATGATG / GGGACGATTCAACGGTCA...CATTTAATGTATTTCACAT / CTTTTTGGGTTACTGTAGTT.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Mutagen:UV/TMP" | WB-STRAIN:WBStrain00027503 | WormBase (WB) | WB | available | PMID:38594249 | WB-STRAIN:MT15019, CGC_MT15019 | 2026-09-12 11:15:31 | 0 | ||||
|
MT15020 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027504 | Caenorhabditis elegans | mir-246(n4636) IV. | Deletion breakpoints are:GATACATCGGTGCAATGAAGA / CATCATCAGATAATATTCTCAA...ATGTTTCGGGTAGGAGCTGT / TCAAACTTTGGACATTGGCATC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:GATACATCGGTGCAATGAAGA / CATCATCAGATAATATTCTCAA...ATGTTTCGGGTAGGAGCTGT / TCAAACTTTGGACATTGGCATC.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab" | WBGene00003340(mir-246) | WBGene00003340(mir-246) | WB-STRAIN:WBStrain00027504 | WormBase (WB) | WB | available | PMID:31307392 | WB-STRAIN:MT15020, CGC_MT15020 | 2026-09-12 11:15:31 | 0 | ||
|
MT15021 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00027505 | Caenorhabditis elegans | mir-78(n4637) IV. | Deletion breakpoints are:CTTTCATACATCTATTTT / ATACGGAAATGTAAAAT...CTTGTTTCAAGCTATCC / ATTTTGCAACAATACTGT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:CTTTCATACATCTATTTT / ATACGGAAATGTAAAAT...CTTGTTTCAAGCTATCC / ATTTTGCAACAATACTGT.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"|"Mutagen:UV/TMP" | WBGene00003306(mir-78) | WBGene00003306(mir-78) | WB-STRAIN:WBStrain00027505 | WormBase (WB) | WB | available | WB-STRAIN:MT15021, CGC_MT15021 | 2026-09-12 11:15:31 | 2 | |||
|
MT18023 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027586 | Caenorhabditis elegans | lin-4(e912) II; mir-237(n4296) X. | Made_by: Ezequiel Alvarez-Saa|"Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73." | WBGene00002993(lin-4)|WBGene00003330(mir-237) | WBGene00002993(lin-4), WBGene00003330(mir-237) | WB-STRAIN:WBStrain00027586 | WormBase (WB) | WB | available | WB-STRAIN:MT18023, CGC_MT18023 | 2026-09-12 11:15:32 | 0 | |||
|
MT18043 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00027588 | Caenorhabditis elegans | mir-240&mir-786(n4541) X. | Deletion breakpoints are: TTGTTGGAGAAATGAATAAA / TGGAACAAAATTAAGAATA...AATGTTTATTATGTTGCAAG / TCTACAAAATTAGGGAACA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Made_by: Horvitz Lab Members" | WBGene00003334(mir-240)|WBGene00045343(mir-786) | WBGene00003334(mir-240), WBGene00045343(mir-786) | WB-STRAIN:WBStrain00027588 | WormBase (WB) | WB | available | WB-STRAIN:MT18043, CGC_MT18043 | 2026-09-12 11:15:32 | 1 | |||
|
MY10 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027656 | Caenorhabditis elegans | EMPTY | Natural isolate; obtained in July 2002 from compost heap in Roxel, Mnster, North-West Germany; frozen within 5 generations after isolation; microsatellite genotype EU3.|"WBStrain provided so WBPaper00061063 paper added based on AFP_Strain data."|"Wild-type natural isolate" | WB-STRAIN:WBStrain00027656 | WormBase (WB) | WB | available | PMID:22301316 PMID:30078564 PMID:33593818 PMID:33820969 PMID:38547054 PMID:38564369 |
WB-STRAIN:MY10, CGC_MY10 | 2026-09-12 11:15:33 | 0 | ||||
|
MY4 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027650 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | Natural isolate; obtained in July 2002 from compost heap in Roxel, Mnster, North-West Germany; frozen within 5 generations after isolation; microsatellite genotype EU3. | WB-STRAIN:WBStrain00027650 | WormBase (WB) | WB | available | WB-STRAIN:MY4, CGC_MY4 | 2026-09-12 11:15:33 | 0 | |||||
|
MY3 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027649 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | Natural isolate; obtained in July 2002 from compost heap in Roxel, Mnster, North-West Germany; frozen within 5 generations after isolation; microsatellite genotype EU3.|"WBStrain mapped, WBPaper00061409 added based on AFP_Strain data."|"WBStrain mapped, WBPaper00061527 added based on AFP_Strain data." | WB-STRAIN:WBStrain00027649 | WormBase (WB) | WB | available | WB-STRAIN:MY3, CGC_MY3 | 2026-09-12 11:15:33 | 0 | |||||
|
MX124 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00027645 | Caenorhabditis elegans | ifta-1(nx61) X. | Homozygous viable with no obvious morphological, locomotory, or behavioral phenotypes. However, these animals display cilia-related chemosensory (Che) defective and dye-fill (Dyf) defective phenotypes. 2009 bp deletion with flanking sequences of GATAAGAGGAAATCTTTTTGGAGAGTTGGA and ATTTAGTTTTTCACAAAGAACACCGCAATA. | WBGene00016935(ifta-1) | WBGene00016935(ifta-1) | WB-STRAIN:WBStrain00027645 | WormBase (WB) | WB | available | PMID:38302462 | WB-STRAIN:MX124, CGC_MX124 | 2026-09-12 11:15:33 | 1 | ||
|
MY1 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00027647 | Caenorhabditis elegans | wild | Natural isolate; obtained in April 2002 from compost heap in Lingen, Emsland, North-West Germany; frozen within 5 generations after isolation; microsatellite genotype EU1. | WB-STRAIN:WBStrain00027647 | WormBase (WB) | WB | available | PMID:22301316 PMID:31422888 PMID:33820969 PMID:34622777 PMID:38564369 PMID:38865452 |
WB-STRAIN:MY1, CGC_MY1 | 2026-09-12 11:15:33 | 2 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.