Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Background:mutant (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

1,464 Results - per page

Show More Columns | Download Top 1000 Results

Organism Name Proper Citation Species Synonyms Notes Phenotype Affected Gene Genomic Alteration Catalog Number Background Database Database Abbreviation Availability Source References Alternate IDs Record Last Update Mentions Count
SD-Cftrem1Sage+/+
 
Resource Report
Resource Website
RRID:RGD_14392817 Rattus norvegicus CFTR ZFN knockout rats possess a 16 bp deletion in exon 3 of the Cystic Fibrosis transmembrane conductance regulator (Cftr), resulting in loss of protein expression. The homozygous mutant rats and wild-type rats are produced by crossing the Cftr heterozygous rats. 14392817 mutant Rat Genome Database (RGD) RGD Unknown 14392817 2026-09-19 01:18:50 0
SD-Cftrem1Sage+/-
 
Resource Report
Resource Website
RRID:RGD_14392813 Rattus norvegicus Cftr ZFN knockout rats possess a 16 bp deletion in exon 3 of the Cystic Fibrosis transmembrane conductance regulator (Cftr), resulting in loss of protein expression. This Cftr heterozygous rats exhibited similar bioelectric and other characteristics to wild-type. inotiv 14392813 mutant Rat Genome Database (RGD) RGD Cryopreserved Embryo; Cryorecovery (as of 2023-06-06) 14392813 2026-09-19 01:18:50 0
ACI.Cg.-Cdkn1bem4Musc
 
Resource Report
Resource Website
RRID:RGD_126928150 Rattus norvegicus The CRISPR-Cas9 system targeted to exon 2 of the rat Cdkn1b was injected to zygotes derived from the Sprague-Dawley outbred rat strain. Two mutations with the highest potential impact on Cdkn1b function were transferred through the germline showing a 32-bp deletion (DEL-32, em1Musc) and a 65-bp deletion (DEL-65, em4Musc), both disrupting the open reading frame of the Cdkn1b gene. The selected mutations were breded to the ACI inbred strain for future study. This mutant strain ACI.Cg.-Cdkn1bem4Musc harbors 65-bp deletion of Cdkn1b exhibits same phenotype as the em1Musc with 32-bp deletion 126928150 mutant Rat Genome Database (RGD) RGD Unknown 126928150 2026-09-19 01:18:49 0
SD-Lrp5em2Vari
 
Resource Report
Resource Website
RRID:RGD_41404648 Rattus norvegicus CRISPR/Cas9 system was used to introduce a 22-bp deletion at the sgRNA2 site of exon 2 in the rat Lrp5 gene of Crl:SD embryos. 41404648 mutant Rat Genome Database (RGD) RGD Unknown 41404648 2026-09-19 01:18:50 0
SD-Myh7bem1Blar-/-
 
Resource Report
Resource Website
RRID:RGD_126925952 Rattus norvegicus The Myh7b knockout SD rats were generated using the CRISPR/Cas9 system targeting exon 2, resulting 7 bases deletion of exon 2 and generated a new termination codon TGA in exon 3. The heterzygous Myh7b+/- rats were crossed to generate littermate controls. The birth ratio of wild type (WT):Myh7b+/-:Myh7b-/- was approximately 1:2:1, indicating that Myh7b-/- did not cause fetal death. 126925952 mutant Rat Genome Database (RGD) RGD Unknown 126925952 2026-09-19 01:18:49 0
SS-Per1em3Mcwi
 
Resource Report
Resource Website
RRID:RGD_13825147 Rattus norvegicus CRISPR/Cas9 system was used to introduce a 1-bp deletion in exon 1 of Per1 gene in SS/JrHsdMcwi rat embryos. Contact MCW rat distribution at [email protected] 13825147 mutant Rat Genome Database (RGD) RGD Unknown 13825147 2026-09-19 01:18:49 0
DA-Tph2em3Mcwi+/-
 
Resource Report
Resource Website
RRID:RGD_14394617 Rattus norvegicus The Tph2em3Mcwi heterozygous mutant was created by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 11-bp frameshift deletion in exon 7. 14394617 mutant Rat Genome Database (RGD) RGD Unknown 14394617 2026-09-19 01:18:50 0
W-Cyp27b1em1Thka
 
Resource Report
Resource Website
RRID:RGD_124713544 Rattus norvegicus This strain was established by injecting Jcl:Wistar embryo with CRISPR/Cas9 system to delete the cysteine at position 462 in exon 8, which is the 5th ligand of heme iron and an active center of Cyp27b1. The resulting mutation is a 25 amino acid deletion (75 bp deletion) in the target site. The mutant was maintained with CE-2 formula diet (CLEA Japan, Inc., Tokyo, Japan) containing 1.15% calcium and 2,100 IU vitamin D3/kg diet. Homozygotes Cyp27b1 mutants were maintained by mating of heterozygotes. 124713544 mutant Rat Genome Database (RGD) RGD Unknown 124713544 2026-09-19 01:18:49 0
SD-Shank2em13Sage
 
Resource Report
Resource Website
RRID:RGD_126790496 Rattus norvegicus The Shank2 KO rat line 13 was generated by zinc finger nuclease technology targeting exon 31 for deletion . Line 13 has a 437 bp deletion around and including the entire exon 31, thereby causing a frameshift and premature stop codon in all three known isoforms of the rat Shank2 mRNA 126790496 mutant Rat Genome Database (RGD) RGD Unknown 126790496 2026-09-19 01:18:49 0
W-Vdrem2Thka
 
Resource Report
Resource Website
RRID:RGD_124713548 Rattus norvegicus This strain was established by injecting Jcl:Wistar embryo with CRISPR/Cas9 system to disrupt the array near the arginine codon (CGC) at position 270 of the Vdr gene. This resulted in 1bp deletion and caused premature stop at p266 of the Vdr gene. They were allowed food and water ad libitum and fed a CE-2 formula diet ( CLEA Japan, Inc., Tokyo, Japan) containing 1.15% calcium and 2,100 IU vitamin D3/kg diet. The Vdr knock out rats for analysis were fed an F-2 formula diet (Oriental Yeast Co., Tokyo, Japan) containing 0.74% calcium and 2000 IU vitamin D/kg diet12 after weaning because the CE-2diet partially reversed their rickets symptoms. Homozygotes Vdr knock out mutants were maintained by mating of heterozygotes. 124713548 mutant Rat Genome Database (RGD) RGD Unknown 124713548 2026-09-19 01:18:50 0
SD-Cd59em1Ask-/-
 
Resource Report
Resource Website
1+ mentions
RRID:RGD_13792606 Rattus norvegicus The CRISPR/Cas9 genome editing system was used to generate Cd59 mutation in the Sprague Dawley embryos. The CRISPR/Cas9 targeting exon 3 of the rat Cd59 created a 11 bp-deletion (TGCAAAACAAA) in exon 3. No protein expression was detected in the blood smear of homozygous mutants. 13792606 mutant Rat Genome Database (RGD) RGD Unknown 13792606 2026-09-19 01:18:49 1
SD-Leprem4Lizh
 
Resource Report
Resource Website
RRID:RGD_21079475 Rattus norvegicus The Lepr knockout rats were generated by CRISPR/Cas9. Two pairs of synthesized oligonucleotides for gRNA targeting on the exon 4 of Lepr, TAGGCAAATCATCTATAACTTC and AAACGAAGTTATAGATGATTTG; TAGGCTGAAAGCTGTCTTTCAG and AAACCTGAAAGACAGCTTTCAG were microinjected into Sprague Dawley (originally from Charles River) zygotes. The rat was genotyped by PCR with the primers, 5-prime-CTTGTGTCCAGAGCCTTCCTATAAC and 5-prime-ATTCCCCATGTTGTCTAGTAGTGATC. For genotyping, a 662-bp fragment of WT and a 368-bp fragment of the Lepr knockout gene were amplified with PCR. Founder 2 was chosen to establish a colony (designated as Lepr-/-), which carried a 298-bp deletion from No. 90043 bp to 90341 bp in the Lepr genome DNA sequence (NC_005104.4) and a 4-bp insertion and resulted in a termination codon TGA, deleting 997 amino acid of LEPR. Western blot analysis of total protein from liver tissue of the Lepr-/- rats confirmed the absence of LEPR. 21079475 mutant Rat Genome Database (RGD) RGD Unknown 21079475 2026-09-19 01:18:49 0
SD-Abcc6em2Qlju+/-
 
Resource Report
Resource Website
RRID:RGD_13792682 Rattus norvegicus This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 23 bp-deletion (TGCGCAGGCCTGAGGGTGAGTCC) from the first coding exon of the rat Abcc6 gene. The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining. 13792682 mutant Rat Genome Database (RGD) RGD Unknown 13792682 2026-09-19 01:18:49 0
WI-Pmchm1Hubr
 
Resource Report
Resource Website
RRID:RGD_150429963 Rattus norvegicus The Pmch mutant rat line was generated by target-selected ENU-driven mutagenesis, and high-throughput resequencing of genomic target sequences in progeny from mutagenized rats (Wistar/Crl background) revealed an ENU-induced premature stop codon in exon 1(K50X) of Pmch in a rat. The heterozygous mutant rat was backcrossed to wild-type Wistar background for six generations to eliminate confounding effects from background mutations induced by ENU. 150429963 mutant Rat Genome Database (RGD) RGD Unknown 150429963 2026-09-19 01:18:49 0
LEW-Glp1rem1Mcwi
 
Resource Report
Resource Website
RRID:RGD_13800749 Rattus norvegicus CRISPR/Cas9 system was used to introduce a 84-bp deletion and skipping of exon 5 of the Glp1r gene in Lew/NCrl embryos. Contact MCW rat distribution at [email protected] 13800749 mutant Rat Genome Database (RGD) RGD Unknown 13800749 2026-09-19 01:18:49 0
WI-Mc4rm1Hubr
 
Resource Report
Resource Website
RRID:RGD_13825199 Rattus norvegicus The Mc4r mutant rat line was generated by target-selected ENU-driven mutagenesis, and high-throughput resequencing of genomic target sequences in progeny from mutagenized rats (Wistar/Crl background) revealed an ENU-induced premature stop codon in helix 8 (K314X) of Mc4r. The heterozygous mutant rat was backcrossed to wild-type Wistar background for six generations to eliminate confounding effects from background mutations induced by ENU. 13825199 mutant Rat Genome Database (RGD) RGD Unknown 13825199 2026-09-19 01:18:49 0
SD-Fahem15Dlli-/-
 
Resource Report
Resource Website
RRID:RGD_14398825 Rattus norvegicus This strain was produced by injecting Sprague Dawley embryo with CRISPR/Cas9 system targeting the exon 2 of rat Fah gene. The resulting mutation is line 15 with a frameshift deletion causing Fah null in homozygotes. None of the Fah-/- newborns survived longer than three days after birth in the absence of NTBC. Upon NTBC addition to the drinking water, the Fah-/- rats underwent normal growth and were indistinguishable from their WT littermates. 14398825 mutant Rat Genome Database (RGD) RGD Unknown 14398825 2026-09-19 01:18:49 0
SS-Sh2b3tm1Mcwi
 
Resource Report
Resource Website
RRID:RGD_13825196 Rattus norvegicus CRISPR/Cas9 and two ssODNs (single-stranded oligodeoxynucleotide) were used to insert loxP sites flanking multiple exons 13825196 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2018-11-21) 13825196 2026-09-19 01:18:49 0
ACI-Pvt1em2Shul/Rrrc
 
Resource Report
Resource Website
RRID:RGD_150520211 Rattus norvegicus Using CRISPR/Cas9, a 568bp region of the Pvt1 gene was deleted from the ACI genome including all of exon 3. This strain is maintained at Rat Resource and Research Center. 150520211 mutant Rat Genome Database (RGD) RGD Unknown (as of 2021-11-09) 150520211 2026-09-19 01:18:51 0
ACI-Pvt1em3Shul
 
Resource Report
Resource Website
RRID:RGD_150520212 Rattus norvegicus using CRISPR/Cas9, exon 8 of the pvt1 gene was deleted from the ACI genome. Resulting in a total excision of 588bp. 150520212 mutant Rat Genome Database (RGD) RGD Live Animals (as of 2021-11-05) 150520212 2026-09-19 01:18:51 0

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.