SYSTEM UPDATE: We will be performing system maintenace Saturday September 26 at 9pm to midnight Pacific Time

Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 19 showing 361 ~ 380 out of 1,458 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:RGD_10054284

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054284

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2018-10-22)
Alternate IDs: 10054284
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Adora1 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 34-bp deletion in the Adora1 gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_10054284 Copy   


  • RRID:RGD_11049145

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11049145

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 11049145
Notes: CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a GFP-Cre-2A behind the last exon of Crh.

Proper citation: RRID:RGD_11049145 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11073612

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals; Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 11073612
Notes: This strain was produced by injecting TALENs targeting the sequence TTTAAATAGTGATTGTCtagcaccatttgaaaTCAGTGTTCTTGGTGGA into SS-Chr 13BN/mcwi rat embryos. The resulting mutation is a 4-bp deletion in the mature rno-mir-29b-1-3p sequence

Proper citation: RRID:RGD_11073612 Copy   


  • RRID:RGD_11531089

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11531089

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 11531089
Notes: The heterozygous ZFN mutant rats were produced by backcrossing mutant founders (SD/Novo-F8em1Sage) with Sprague Dawley. Genotyping of the offspring was carried out by PCR amplification of the deletion fragment which caused a premature translation stop.

Proper citation: RRID:RGD_11531089 Copy   


  • RRID:RGD_10413852

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10413852

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 10413852
Notes: This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 23 bp-deletion (TGCGCAGGCCTGAGGGTGAGTCC) from the first coding exon of the rat Abcc6 gene. The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining.

Proper citation: RRID:RGD_10413852 Copy   


  • RRID:RGD_11040980

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11040980

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo (as of 2017-05-02)
Alternate IDs: 11040980
Notes: By CRISPR/Cas9 system, mutation was introduced in dystrophin (Dmd) gene of Wistar-Imamichi rat: deletion of exon3 to exon16 National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_11040980 Copy   


  • RRID:RGD_10450489

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10450489

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 10450489
Notes: CRISPR/Cas9 system was used to generate this mutant; sgRNA+Cas9+ plasmid was injected into zygote of SD rat that added a 2a-NpHR-EYFP-2a-ChR2-mcherry-ires-WGA-cre behind the last exon of Bsn Institute of Neuroscience, Chinese Academy of Sciences

Proper citation: RRID:RGD_10450489 Copy   


  • RRID:RGD_10413858

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10413858

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 10413858
Notes: This strain was made by ZFN mutagenesis. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 11-bp deletion from cDNA position 39-49 (CTGCGCAGGCC). The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining.

Proper citation: RRID:RGD_10413858 Copy   


  • RRID:RGD_10402822

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10402822

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryorecovery (as of 2017-01-26)
Alternate IDs: 10402822
Notes: This strain was produced by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 11-bp frameshift deletion in exon 7.

Proper citation: RRID:RGD_10402822 Copy   


  • RRID:RGD_11041108

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11041108

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm
Alternate IDs: 11041108
Notes: The Laboratory of Reproductive Toxicology at the Institute of Environmental Toxicology has been maintaining a Wistar derived PD strain of rats. In 1986, 1 female and 2 males exhibiting very short and sparse vibrissae were found in a litter of 7 parented by a pd/pd female and phenotypically normal pd/+ male. In 2008, a male Wistar rat and F56 female were crossed, and obtained heterozygous rats were sib-mated. After that, sib mating between homozygous rats was started. National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_11041108 Copy   


  • RRID:RGD_11040527

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11040527

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 11040527
Notes: ZFN mutant founders were backcrossed with SHR/NCrl to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.

Proper citation: RRID:RGD_11040527 Copy   


  • RRID:RGD_11040525

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11040525

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 11040525
Notes: ZFN mutant founders were backcrossed with SHR/NCrl to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.

Proper citation: RRID:RGD_11040525 Copy   


  • RRID:RGD_11553899

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11553899

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 11553899
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Trpv2 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp deletion in Exon 4 of the Trpv2 gene. Contact MCW rat distribution at [email protected]

Proper citation: RRID:RGD_11553899 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11040950

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-07-12)
Alternate IDs: 11040950
Notes: This strain was established by Zinc-finger nucleases (ZFNs) method causing 20-bp deletion in the exon1 of Prkdc gene and a 653-bp deletion Il2rg gene. Background strain: TM/Kyo National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_11040950 Copy   


  • RRID:RGD_11040957

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11040957

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm
Alternate IDs: 11040957
Notes: This strain was established by ENU mutagenesis (gene-driven) using F344/NSlc and has a missense mutation(R271C). National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_11040957 Copy   


  • RRID:RGD_10402819

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10402819

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Live Animals; Cryopreserved Sperm (as of 2021-11-03)
Alternate IDs: 10402819
Notes: This strain was produced by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 7.

Proper citation: RRID:RGD_10402819 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10401845

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Unknown
Alternate IDs: 10401845
Notes: ZFN mutant founders were backcrossed with WKY/Cruk to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. The resulting mutation 77 has a stop codon, 15 amino acids from the ZFN-binding site, that resulted in a 490 amino acids (54 kDa) truncated protein, 198 amino acids smaller than the WT protein.

Proper citation: RRID:RGD_10401845 Copy   


  • RRID:RGD_11040946

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11040946

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-06-08)
Alternate IDs: 11040946
Notes: This strain was established by Zinc-finger nucleases (ZFNs) method taregting exon1 of rat Prkdc gene, resulting a 46-deletion. Background strain: F344/Stm National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_11040946 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11040977

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Sperm (as of 2017-08-08)
Alternate IDs: 11040977
Notes: CAG-GFP vector was knock-in into the rat ROSA26 locus by CRISPR/Cas9 system. Background strain: Crlj:WI. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature. National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_11040977 Copy   


  • RRID:RGD_11040969

    This resource has 1+ mentions.

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=11040969

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Availability: Cryopreserved Embryo
Alternate IDs: 11040969
Notes: derived from Wistar Hannover GALAS rats National BioResource Project for the Rat in Japan

Proper citation: RRID:RGD_11040969 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X