Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00027457
Source Database: WormBase (WB)
Affected Genes: WBGene00019584(set-12)
Genomic Alteration: WBGene00019584(set-12)
Availability: available
Source References: EMPTY
Synonyms: set-12(n4442) X.
Alternate IDs: WB-STRAIN:MT14401, CGC_MT14401
Notes: Deletion of K09F5.5, a putative SET-domain-encoding gene. From 2002 deletion library. This deletion removes from the middle of the second exon to the middle of the fourth exon. It is predicted to remove exons that encode the AWS, SET and PostSET domains.
Proper citation: RRID:WB-STRAIN:WBStrain00027457 Copy
http://www.wormbase.org/db/get?name=WBStrain00027450
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: nDf50 II.
Alternate IDs: WB-STRAIN:MT14119, CGC_MT14119
Notes: Made_by: Horvitz Lab|"Partially penetrant embryonic lethal phenotype. mir-35 though mir-41 are deleted in nDf50. Deletion breakpoints are: TGGTTTCTTCCACAGTGGTACTTTCCATTA / GAACTATCACCGGGT...GGGTCAAATGTTTATA / CAGTTGTGCTACTAAACGTATTGTTACACG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Partially penetrant embryonic lethal phenotype. mir-35 though mir-41 are deleted in nDf50. Deletion breakpoints are: TGGTTTCTTCCACAGTGGTACTTTCCATTA / GAACTATCACCGGGT...GGGTCAAATGTTTATA / CAGTTGTGCTACTAAACGTATTGTTACACG.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."
Proper citation: RRID:WB-STRAIN:WBStrain00027450 Copy
http://www.wormbase.org/db/get?name=WBStrain00027451
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: nDf53 III; nDf54 X.
Alternate IDs: WB-STRAIN:MT14128, CGC_MT14128
Notes: Removes mir-80, mir-81, mir-82, mir-227, and T07D1.2 (exons 2-6). Reference: Alvarez-Saavedra E, Horvitz HR. Curr Biol. 2010 Feb 23;20(4):367-73.
Proper citation: RRID:WB-STRAIN:WBStrain00027451 Copy
http://www.wormbase.org/db/get?name=WBStrain00027453
Source Database: WormBase (WB)
Affected Genes: WBGene00003366(mir-273)
Genomic Alteration: WBGene00003366(mir-273)
Availability: available
Source References: EMPTY
Synonyms: mir-273(n4438) II.
Alternate IDs: WB-STRAIN:MT14347, CGC_MT14347
Notes: Deletion breakpoints are:TGGTACTGGCCCCACTTTGATAGT / CTCAAGGCTT...TTAGCGCTAT / AAAAATTTGTACATCTCTGCTC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:TGGTACTGGCCCCACTTTGATAGT / CTCAAGGCTT...TTAGCGCTAT / AAAAATTTGTACATCTCTGCTC.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00027453 Copy
http://www.wormbase.org/db/get?name=WBStrain00027447
Source Database: WormBase (WB)
Affected Genes: WBGene00003307(mir-79)
Genomic Alteration: WBGene00003307(mir-79)
Availability: available
Source References: EMPTY
Synonyms: mir-79(n4126) I.
Alternate IDs: WB-STRAIN:MT14091, CGC_MT14091
Notes: Deletion breakpoints are:TATCTTCTTATTCGGGGCGTCCTTG / TACCTATCTTG...AAATTTTCTGTA / GGTCTTAAATTTTTTCCTAACAAAAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:TATCTTCTTATTCGGGGCGTCCTTG / TACCTATCTTG...AAATTTTCTGTA / GGTCTTAAATTTTTTCCTAACAAAAAA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00027447 Copy
http://www.wormbase.org/db/get?name=WBStrain00027449
Source Database: WormBase (WB)
Affected Genes: WBGene00003312(mir-84)|WBGene00003335(mir-241)
Genomic Alteration: WBGene00003312(mir-84), WBGene00003335(mir-241)
Availability: available
Source References: EMPTY
Synonyms: mir-241(n4315) V; mir-84(n4037) X.
Alternate IDs: WB-STRAIN:MT14118, CGC_MT14118
Notes: Superficially WT.
Proper citation: RRID:WB-STRAIN:WBStrain00027449 Copy
http://www.wormbase.org/db/get?name=WBStrain00027444
Source Database: WormBase (WB)
Affected Genes: WBGene00020657(lgc-53)
Genomic Alteration: WBGene00020657(lgc-53)
Availability: available
Source References: PMID:32510332
Synonyms: lgc-53(n4330) X.
Alternate IDs: WB-STRAIN:MT13952, CGC_MT13952
Notes: 1.463 kb deletion in T21F2.1 encoding ligand-gated chloride channel. Homozygous viable.|"WBStrain mapped, WBPaper00059778 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00027444 Copy
http://www.wormbase.org/db/get?name=WBStrain00027446
Source Database: WormBase (WB)
Affected Genes: WBGene00001995(hpl-1)
Genomic Alteration: WBGene00001995(hpl-1)
Availability: available
Source References: EMPTY
Synonyms: hpl-1(n4317) X.
Alternate IDs: WB-STRAIN:MT13971, CGC_MT13971
Notes: Deletion removes the first exon with the start codon and nearly all of the exonic sequence except the last exon.
Proper citation: RRID:WB-STRAIN:WBStrain00027446 Copy
http://www.wormbase.org/db/get?name=WBStrain00027483
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: nDf50 nDf49 II; nEx1188.
Alternate IDs: WB-STRAIN:MT14752, CGC_MT14752
Notes: Made_by: Ezequiel Alvarez-Saa|"nEx1188 [mir-35 mir-45(genomic) + sur-5::GFP]. Maintain by picking GFP+. Array rescues nDf50 nDf49 (mir-35 mir-45) lethality. Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73."
Proper citation: RRID:WB-STRAIN:WBStrain00027483 Copy
http://www.wormbase.org/db/get?name=WBStrain00027480
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00009671(mfap-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00009671(mfap-1)
Availability: available
Source References: EMPTY
Synonyms: mfap-1(n4564 n5214) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:MT14728, CGC_MT14728
Notes: Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP mfap-1 homozygotes. Pick WT GFP and check for correct segregation of progeny to maintain. mfap-1(n4564 n5214) mutants exhibit temperature-sensitive lethality: at 15C, (n4564 n5214) homozygous animals grow and behave similarly to wild-type; at 20C mutant animals grow more slowly, have few progeny and are hyperactive; at 25C the mutant strain is embryonically lethal. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Reference: Ma L, et al. PLoS Genet. 2012;8(7):e1002827.|"Segregates WT green-glowing heterozygotes and non-glowing mfap-1 homozygotes. mfap-1(n4564 n5214) mutants exhibit temperature-sensitive lethality: at 15C, (n4564 n5214) homozygous animals grow and behave similarly to wild-type; at 20C mutant animals grow more slowly, have few progeny and are hyperactive; at 25C the mutant strain is embryonically lethal. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Reference: Ma L, et al. PLoS Genet. 2012;8(7):e1002827."
Proper citation: RRID:WB-STRAIN:WBStrain00027480 Copy
http://www.wormbase.org/db/get?name=WBStrain00027481
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: nDf51 V; nEx1184.
Alternate IDs: WB-STRAIN:MT14748, CGC_MT14748
Notes: nEx1184 [sur-5::GFP]. Maintain by picking GFP+. nEx1184 rescues the lethality and extra seam cells in nDf51. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).|"nEx1184 [sur-5::GFP]. nEx1184 rescues the lethality and extra seam cells in nDf51, a deletion of mir-48 and mir-241. Maintain by picking GFP+."
Proper citation: RRID:WB-STRAIN:WBStrain00027481 Copy
http://www.wormbase.org/db/get?name=WBStrain00027476
Source Database: WormBase (WB)
Affected Genes: WBGene00020767(lgc-40)
Genomic Alteration: WBGene00020767(lgc-40)
Availability: available
Source References: EMPTY
Synonyms: lgc-40(n4545) X.
Alternate IDs: WB-STRAIN:MT14678, CGC_MT14678
Notes: 1.029 kb deletion in T24D8.1 encoding ligand-gated chloride channel that is a low affinity serotonin receptor. Homozygous viable.
Proper citation: RRID:WB-STRAIN:WBStrain00027476 Copy
http://www.wormbase.org/db/get?name=WBStrain00027478
Source Database: WormBase (WB)
Affected Genes: WBGene00003351(mir-257)
Genomic Alteration: WBGene00003351(mir-257)
Availability: available
Source References: EMPTY
Synonyms: mir-257(n4548) V.
Alternate IDs: WB-STRAIN:MT14682, CGC_MT14682
Notes: Deletion breakpoints are:GACCTTGGACTTCAGCACATCCGGTTTTCCA / CTCGGAACTTGACG....CCTGCAGTTCTTCCAT / GATGTACTCAGGGCCTTTAATTTTGTACATGCTCCATAGGAT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:GACCTTGGACTTCAGCACATCCGGTTTTCCA / CTCGGAACTTGACG....CCTGCAGTTCTTCCAT / GATGTACTCAGGGCCTTTAATTTTGTACATGCTCCATAGGAT.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00027478 Copy
http://www.wormbase.org/db/get?name=WBStrain00027472
Source Database: WormBase (WB)
Affected Genes: WBGene00003323(mir-230)
Genomic Alteration: WBGene00003323(mir-230)
Availability: available
Source References: PMID:38594249
Synonyms: mir-230(n4535) X.
Alternate IDs: WB-STRAIN:MT14662, CGC_MT14662
Notes: Deletion breakpoints are:ACATCATCATCATAACAA / GCCTTTCACAAATAAGATC...ACTTATATTTCTTGTTTATTTTTTT / AAATGTTTTTTTTACTATTGC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:ACATCATCATCATAACAA / GCCTTTCACAAATAAGATC...ACTTATATTTCTTGTTTATTTTTTT / AAATGTTTTTTTTACTATTGC.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"
Proper citation: RRID:WB-STRAIN:WBStrain00027472 Copy
http://www.wormbase.org/db/get?name=WBStrain00027473
Source Database: WormBase (WB)
Affected Genes: WBGene00001175(egl-6)
Genomic Alteration: WBGene00001175(egl-6)
Availability: available
Source References: PMID:37769660
Synonyms: egl-6(n4537) X.
Alternate IDs: WB-STRAIN:MT14666, CGC_MT14666
Notes: 2201 bp deletion in C46F4.1. Reference: Ringstad N, Horvitz HR. Nat Neurosci. 2008 Oct;11(10):1168-76.|"Supplementary_genotype egl-6(n4537lf)"
Proper citation: RRID:WB-STRAIN:WBStrain00027473 Copy
http://www.wormbase.org/db/get?name=WBStrain00027470
Source Database: WormBase (WB)
Affected Genes: WBGene00001078(dpy-19)|WBGene00001609(glp-1)|WBGene00011729(set-16)
Genomic Alteration: WBGene00001078(dpy-19), WBGene00001609(glp-1), WBGene00011729(set-16)
Availability: available
Source References: EMPTY
Synonyms: set-16(n4526)/qC1 [dpy-19(e1259) glp-1(q339)] III.
Alternate IDs: WB-STRAIN:MT14615, CGC_MT14615
Notes: Mutagen:UV/TMP|"T12D8.1 deletion. Putative HMTase-encoding gene, from F21E9 (2001 library). Heterozygotes are WT, and segregate Dpy Steriles (qC1 homozygotes) and larval lethals (set-16 homozygotes)."
Proper citation: RRID:WB-STRAIN:WBStrain00027470 Copy
http://www.wormbase.org/db/get?name=WBStrain00027471
Source Database: WormBase (WB)
Affected Genes: WBGene00003358(mir-265)
Genomic Alteration: WBGene00003358(mir-265)
Availability: available
Source References: EMPTY
Synonyms: mir-265(n4534) IV.
Alternate IDs: WB-STRAIN:MT14661, CGC_MT14661
Notes: Deletion breakpoints are:ACTTTCGAAAAATTTTGCCAT / GTTTTCCAATTT...TATTATTTTCAGAAA / GCCAAAATATTTCTAAATTCCTATATAAATTTCAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:ACTTTCGAAAAATTTTGCCAT / GTTTTCCAATTT...TATTATTTTCAGAAA / GCCAAAATATTTCTAAATTCCTATATAAATTTCAAA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"
Proper citation: RRID:WB-STRAIN:WBStrain00027471 Copy
http://www.wormbase.org/db/get?name=WBStrain00027469
Source Database: WormBase (WB)
Affected Genes: WBGene00003327(mir-234)
Genomic Alteration: WBGene00003327(mir-234)
Availability: available
Source References: EMPTY
Synonyms: mir-234(n4520) II.
Alternate IDs: WB-STRAIN:MT14588, CGC_MT14588
Notes: Deletion breakpoints are:CAACGTTTCCAAACTGT / AACGTAAATATACAACAC...TGATGGGGGGGGGGGGTCAAGGAAA / GAAGAAAAGGGAAGAAAGAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:CAACGTTTCCAAACTGT / AACGTAAATATACAACAC...TGATGGGGGGGGGGGGTCAAGGAAA / GAAGAAAAGGGAAGAAAGAA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"
Proper citation: RRID:WB-STRAIN:WBStrain00027469 Copy
http://www.wormbase.org/db/get?name=WBStrain00027467
Source Database: WormBase (WB)
Affected Genes: WBGene00004179(prg-2)
Genomic Alteration: WBGene00004179(prg-2)
Availability: available
Source References: EMPTY
Synonyms: prg-2(nDf57) IV.
Alternate IDs: WB-STRAIN:MT14531, CGC_MT14531
Notes: Deletion breakpoints: ATCGGGATGAAGTTTGCAAA
Proper citation: RRID:WB-STRAIN:WBStrain00027467 Copy
http://www.wormbase.org/db/get?name=WBStrain00027500
Source Database: WormBase (WB)
Affected Genes: WBGene00006600(tph-1)
Genomic Alteration: WBGene00006600(tph-1)
Availability: available
Source References: PMID:33007049, PMID:36653384, PMID:37155851, PMID:38302462, PMID:38555276
Synonyms: tph-1(n4622) II.
Alternate IDs: WB-STRAIN:MT14984, CGC_MT14984
Notes: Egl. Reduced pharyngeal pumping.|"Made_by: Dan Omura"|"WBStrain provided so WBPaper00060405 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00027500 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.