Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00027404
Source Database: WormBase (WB)
Affected Genes: WBGene00002997(lin-8)|WBGene00003041(lin-61)
Genomic Alteration: WBGene00002997(lin-8), WBGene00003041(lin-61)
Availability: available
Source References: EMPTY
Synonyms: lin-61(n3809) I; lin-8(n2731) II.
Alternate IDs: WB-STRAIN:MT12839, CGC_MT12839
Notes: SynMuv. Reference: Andersen EC, et al. Genetics. 2008 Aug;179(4):2001-12. Harrison MM, et al. Genetics. 2007 May;176(1):255-71.
Proper citation: RRID:WB-STRAIN:WBStrain00027404 Copy
http://www.wormbase.org/db/get?name=WBStrain00027487
Source Database: WormBase (WB)
Affected Genes: WBGene00003324(mir-231)
Genomic Alteration: WBGene00003324(mir-231)
Availability: available
Source References: EMPTY
Synonyms: mir-231(n4571) III.
Alternate IDs: WB-STRAIN:MT14768, CGC_MT14768
Notes: Deletion breakpoints are: CATAAATTTCAGGAAAGC / ATGTGGTAAAATATGAAT...ATGTGAATGAAAATAAACC / GCCAAAAATATCAAAAAGTG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Made_by: Horvitz Lab Members"|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00027487 Copy
http://www.wormbase.org/db/get?name=WBStrain00027436
Source Database: WormBase (WB)
Affected Genes: WBGene00003039(mir-48)
Genomic Alteration: WBGene00003039(mir-48)
Availability: available
Source References: EMPTY
Synonyms: mir-48(n4097) V.
Alternate IDs: WB-STRAIN:MT13650, CGC_MT13650
Notes: Mutagen:UV/TMP|"Worms are weakly retarded, with cold-sensitive supernumerary adult-stage molt phenotype (<5% at 20C, about 70% at 15C). 293 bp deletion encompassing the lin-58 gene. lin-58 is at 5908 to 5885 of F56A12. Deletion goes from -45 to +248 from start of lin-58."|"Worms are weakly retarded, with cold-sensitive supernumerary adult-stage molt phenotype (<5% at 20C, about 70% at 15C). 293 bp deletion encompassing the mir-48 gene. mir-48 is at 5908 to 5885 of F56A12. Deletion goes from -45 to +248 from start of mir-48."
Proper citation: RRID:WB-STRAIN:WBStrain00027436 Copy
http://www.wormbase.org/db/get?name=WBStrain00027437
Source Database: WormBase (WB)
Affected Genes: WBGene00003312(mir-84)
Genomic Alteration: WBGene00003312(mir-84)
Availability: available
Source References: EMPTY
Synonyms: mir-84(n4037) X.
Alternate IDs: WB-STRAIN:MT13651, CGC_MT13651
Notes: Mutagen:UV/TMP|"Superficially WT. mir-84 deletion is between 2891 and 3682 of clone B0395. mir-84 is at 3351-3330 in B0395."
Proper citation: RRID:WB-STRAIN:WBStrain00027437 Copy
http://www.wormbase.org/db/get?name=WBStrain00027439
Source Database: WormBase (WB)
Affected Genes: WBGene00003330(mir-237)
Genomic Alteration: WBGene00003330(mir-237)
Availability: available
Source References: EMPTY
Synonyms: mir-237(n4296) X.
Alternate IDs: WB-STRAIN:MT13653, CGC_MT13653
Notes: Deletion breakpoints are:GAAGATCATTCTTAAATCTGTTTAGCA / TTTTGAAAGTTT...ACTGCATTAGAACT / GCAAAAAAAAGTTTCGAGAAAAGTGGCT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:GAAGATCATTCTTAAATCTGTTTAGCA / TTTTGAAAGTTT...ACTGCATTAGAACT / GCAAAAAAAAGTTTCGAGAAAAGTGGCT.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00027439 Copy
http://www.wormbase.org/db/get?name=WBStrain00027432
Source Database: WormBase (WB)
Affected Genes: WBGene00003273(mir-45)
Genomic Alteration: WBGene00003273(mir-45)
Availability: available
Source References: PMID:38594249
Synonyms: mir-45(n4280) II.
Alternate IDs: WB-STRAIN:MT13433, CGC_MT13433
Notes: Deletion breakpoints are:TCCACCAGCAAAAAGCCGT / CTCCAAAGAAGGCTGCTCCG...AAAAAACTACAAATTCTCG / TTTCCATTACTTTTCAGAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:TCCACCAGCAAAAAGCCGT / CTCCAAAGAAGGCTGCTCCG...AAAAAACTACAAATTCTCG / TTTCCATTACTTTTCAGAAA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"
Proper citation: RRID:WB-STRAIN:WBStrain00027432 Copy
http://www.wormbase.org/db/get?name=WBStrain00027430
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: nDf49 II.
Alternate IDs: WB-STRAIN:MT13372, CGC_MT13372
Notes: Made_by: Horvitz Lab|"mir-42, mir43 and mir-44 are deleted in nDf49. Deletion breakpoints are:GGAGCTTGCACTTCCAAAAC / CCGACGATCTGAGAAATCC...GCTATGTATCAATCTACG / CGATAGCTAGAAAAAAAT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"mir-42, mir43 and mir-44 are deleted in nDf49. Deletion breakpoints are:GGAGCTTGCACTTCCAAAAC / CCGACGATCTGAGAAATCC...GCTATGTATCAATCTACG / CGATAGCTAGAAAAAAAT.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."
Proper citation: RRID:WB-STRAIN:WBStrain00027430 Copy
http://www.wormbase.org/db/get?name=WBStrain00027429
Source Database: WormBase (WB)
Affected Genes: WBGene00019883(met-2)
Genomic Alteration: WBGene00019883(met-2)
Availability: available
Source References: PMID:31815663, PMID:32451438, PMID:34648748
Synonyms: met-2(n4256) III
Alternate IDs: WB-STRAIN:MT13293, CGC_MT13293
Notes: Deletion of R05D3.11.|"Reference WBPaper00059681 added based on published strain data identified by Textpresso literature search."
Proper citation: RRID:WB-STRAIN:WBStrain00027429 Copy
http://www.wormbase.org/db/get?name=WBStrain00027425
Source Database: WormBase (WB)
Affected Genes: WBGene00007029(mys-1)
Genomic Alteration: WBGene00007029(mys-1)
Availability: available
Source References: EMPTY
Synonyms: mys-1(n4075) V/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:MT13172, CGC_MT13172
Notes: Heterozygotes are WT and GFP+ and segregate Ste GFP- and dead eggs. The myo-1(n4075) deletion removes 1010 nucleotides from the mys-1 locus (VC5.4). Relative to the first nucleotide of the predicted initiator ATG, the deletion begins at about nt. 106 and ends at about nt. 1115 to give the junction sequence GATGCCGGT/TCTGCGTGGG.|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00027425 Copy
http://www.wormbase.org/db/get?name=WBStrain00027427
Source Database: WormBase (WB)
Affected Genes: WBGene00022149(lin-65)
Genomic Alteration: WBGene00022149(lin-65)
Availability: available
Source References: EMPTY
Synonyms: lin-65(n3441) I.
Alternate IDs: WB-STRAIN:MT13232, CGC_MT13232
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00027427 Copy
http://www.wormbase.org/db/get?name=WBStrain00027428
Source Database: WormBase (WB)
Affected Genes: WBGene00003319(mir-124)
Genomic Alteration: WBGene00003319(mir-124)
Availability: available
Source References: EMPTY
Synonyms: mir-124(n4255) IV.
Alternate IDs: WB-STRAIN:MT13292, CGC_MT13292
Notes: Deletion breakpoints are:GTCGCTCATTGATTCACATCCATTTTGAG / AAGGATGGTT...GAATGCCACGTG / GCCATGATGGGGCTCCCATTGAAT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:GTCGCTCATTGATTCACATCCATTTTGAG / AAGGATGGTT...GAATGCCACGTG / GCCATGATGGGGCTCCCATTGAAT.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00027428 Copy
http://www.wormbase.org/db/get?name=WBStrain00027422
Source Database: WormBase (WB)
Affected Genes: WBGene00004829(sli-1)
Genomic Alteration: WBGene00004829(sli-1)
Availability: available
Source References: EMPTY
Synonyms: sli-1(n3538) X.
Alternate IDs: WB-STRAIN:MT13032, CGC_MT13032
Notes: SynMuv.
Proper citation: RRID:WB-STRAIN:WBStrain00027422 Copy
http://www.wormbase.org/db/get?name=WBStrain00027461
Source Database: WormBase (WB)
Affected Genes: WBGene00003279(mir-51)
Genomic Alteration: WBGene00003279(mir-51)
Availability: available
Source References: EMPTY
Synonyms: mir-51(n4473) IV.
Alternate IDs: WB-STRAIN:MT14450, CGC_MT14450
Notes: Deletion breakpoints are: TTTGAATGAATATCTGGTTACCAAAA / CAATTACCA...CCAAAACATACGGT / TGTGAAAGGAAAGAAAAGCTTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Made_by: Horvitz Lab Members"
Proper citation: RRID:WB-STRAIN:WBStrain00027461 Copy
http://www.wormbase.org/db/get?name=WBStrain00027462
Source Database: WormBase (WB)
Affected Genes: WBGene00003304(mir-76)
Genomic Alteration: WBGene00003304(mir-76)
Availability: available
Source References: EMPTY
Synonyms: mir-76(n4474) III.
Alternate IDs: WB-STRAIN:MT14451, CGC_MT14451
Notes: Deletion breakpoints are:ATGTCTTAATTTCTAGT / GGAGCTATTGATTTTCGAAA...TGGCCTCGATTTTCTTCT / CGCAATATGGATCGTTGC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:ATGTCTTAATTTCTAGT / GGAGCTATTGATTTTCGAAA...TGGCCTCGATTTTCTTCT / CGCAATATGGATCGTTGC.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00027462 Copy
http://www.wormbase.org/db/get?name=WBStrain00027464
Source Database: WormBase (WB)
Affected Genes: WBGene00018023(set-11)
Genomic Alteration: WBGene00018023(set-11)
Availability: available
Source References: EMPTY
Synonyms: set-11(n4488) II.
Alternate IDs: WB-STRAIN:MT14480, CGC_MT14480
Notes: Deletion allele. Reference: Andersen EC, Horvitz HR. Development. 2007 Aug;134(16):2991-9.
Proper citation: RRID:WB-STRAIN:WBStrain00027464 Copy
http://www.wormbase.org/db/get?name=WBStrain00027460
Source Database: WormBase (WB)
Affected Genes: WBGene00003325(mir-232)
Genomic Alteration: WBGene00003325(mir-232)
Availability: available
Source References: EMPTY
Synonyms: mir-232(nDf56) IV.
Alternate IDs: WB-STRAIN:MT14449, CGC_MT14449
Notes: Deletion breakpoints are: GATGTATTGGGAGTCTTTTTAGGT / TATGGACCAGG...TTTCGTGCGT / CACTTTTTTTATAAGCTCTACCGTATA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Made_by: Horvitz Lab Members"
Proper citation: RRID:WB-STRAIN:WBStrain00027460 Copy
http://www.wormbase.org/db/get?name=WBStrain00027458
Source Database: WormBase (WB)
Affected Genes: WBGene00003321(mir-228)
Genomic Alteration: WBGene00003321(mir-228)
Availability: available
Source References: EMPTY
Synonyms: mir-228(n4382) IV.
Alternate IDs: WB-STRAIN:MT14446, CGC_MT14446
Notes: Deletion breakpoints are: GTACACAGAACAATAGAAATCGCCT / CGTTTCTGTTT...CTACGATATTAT / GTCCGAATTAAATTGCTTTTTTTTTC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Made_by: Horvitz Lab Members"|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00027458 Copy
http://www.wormbase.org/db/get?name=WBStrain00027459
Source Database: WormBase (WB)
Affected Genes: WBGene00003303(mir-75)|WBGene00003307(mir-79)
Genomic Alteration: WBGene00003303(mir-75), WBGene00003307(mir-79)
Availability: available
Source References: EMPTY
Synonyms: mir-79(n4126) I; mir-75(n4472) X.
Alternate IDs: WB-STRAIN:MT14448, CGC_MT14448
Notes: Reference: Curr Bio (2010) doi:10.1016/j.cub.2009.12.051.
Proper citation: RRID:WB-STRAIN:WBStrain00027459 Copy
http://www.wormbase.org/db/get?name=WBStrain00027454
Source Database: WormBase (WB)
Affected Genes: WBGene00001502(ftt-2)
Genomic Alteration: WBGene00001502(ftt-2)
Availability: available
Source References: EMPTY
Synonyms: ftt-2(n4426) X.
Alternate IDs: WB-STRAIN:MT14355, CGC_MT14355
Notes: Mutagen:UV/TMP|"Superficially WT. Low brood size. Usually bag at day 2-3 of adulthood. 650nt deletion takes out a promoter and an ATG; predicted to be a molecular null."
Proper citation: RRID:WB-STRAIN:WBStrain00027454 Copy
http://www.wormbase.org/db/get?name=WBStrain00027455
Source Database: WormBase (WB)
Affected Genes: WBGene00001995(hpl-1)|WBGene00019883(met-2)
Genomic Alteration: WBGene00001995(hpl-1), WBGene00019883(met-2)
Availability: available
Source References: EMPTY
Synonyms: met-2(n4256) III; hpl-1(n4317) X.
Alternate IDs: WB-STRAIN:MT14378, CGC_MT14378
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00027455 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.