Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 185 showing 3681 ~ 3700 out of 64,152 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:WB-STRAIN:WBStrain00027353

http://www.wormbase.org/db/get?name=WBStrain00027353

Source Database: WormBase (WB)
Affected Genes: WBGene00003909(pag-3)
Genomic Alteration: WBGene00003909(pag-3)
Availability: available
Source References: EMPTY
Synonyms: pag-3(n3098) X.
Alternate IDs: WB-STRAIN:MT8987, CGC_MT8987
Notes: Kinker Unc, neuronal lineage defects including lineage reiterations and abnormal corpse pattern in ventral cord. Allele causes W113 opal.

Proper citation: RRID:WB-STRAIN:WBStrain00027353 Copy   


  • RRID:WB-STRAIN:WBStrain00027354

http://www.wormbase.org/db/get?name=WBStrain00027354

Source Database: WormBase (WB)
Affected Genes: WBGene00005019(sqv-1)|WBGene00006761(unc-24)
Genomic Alteration: WBGene00005019(sqv-1), WBGene00006761(unc-24)
Availability: available
Source References: PMID:9927677
Synonyms: unc-24(e138) sqv-1(n2819) IV/nT1 [unc-?(n754) let-?] (IV;V).
Alternate IDs: WB-STRAIN:MT8998, CGC_MT8998
Notes: Heterozygotes are Unc and segregate Uncs, SqvUncs and dead eggs. n2819: mid-L4 vulva abnormal, sterile.

Proper citation: RRID:WB-STRAIN:WBStrain00027354 Copy   


  • RRID:WB-STRAIN:WBStrain00027350

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00027350

Source Database: WormBase (WB)
Affected Genes: WBGene00003006(lin-17)
Genomic Alteration: WBGene00003006(lin-17)
Availability: available
Source References: PMID:8804313
Synonyms: lin-17(n3091) I.
Alternate IDs: WB-STRAIN:MT8904, CGC_MT8904
Notes: Mail tale abnormal. Bivulva.

Proper citation: RRID:WB-STRAIN:WBStrain00027350 Copy   


  • RRID:WB-STRAIN:WBStrain00027348

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00027348

Source Database: WormBase (WB)
Affected Genes: WBGene00001061(dpl-1)
Genomic Alteration: WBGene00001061(dpl-1)
Availability: available
Source References: EMPTY
Synonyms: dpl-1(n2994) II.
Alternate IDs: WB-STRAIN:MT8879, CGC_MT8879
Notes: Synthetic Muv B.

Proper citation: RRID:WB-STRAIN:WBStrain00027348 Copy   


  • RRID:WB-STRAIN:WBStrain00027349

http://www.wormbase.org/db/get?name=WBStrain00027349

Source Database: WormBase (WB)
Affected Genes: WBGene00000421(ced-7)
Genomic Alteration: WBGene00000421(ced-7)
Availability: available
Source References: PMID:9635425, PMID:33759761
Synonyms: ced-7(n2094) III.
Alternate IDs: WB-STRAIN:MT8886, CGC_MT8886
Notes: Unengulfed cell corpses. Strong allele of ced-7.|"WBStrain provided so WBPaper00061198 paper added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00027349 Copy   


  • RRID:WB-STRAIN:WBStrain00027344

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00027344

Source Database: WormBase (WB)
Affected Genes: WBGene00003035(lin-52)
Genomic Alteration: WBGene00003035(lin-52)
Availability: available
Source References: PMID:31397537
Synonyms: lin-52(n771) III.
Alternate IDs: WB-STRAIN:MT8839, CGC_MT8839
Notes: Made_by: Ferguson/Jeff Thomas|"synMuv class B."

Proper citation: RRID:WB-STRAIN:WBStrain00027344 Copy   


  • RRID:WB-STRAIN:WBStrain00027346

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00027346

Source Database: WormBase (WB)
Affected Genes: WBGene00003037(lin-54)
Genomic Alteration: WBGene00003037(lin-54)
Availability: available
Source References: EMPTY
Synonyms: lin-54(n2231) IV.
Alternate IDs: WB-STRAIN:MT8841, CGC_MT8841
Notes: synMuv class B.

Proper citation: RRID:WB-STRAIN:WBStrain00027346 Copy   


  • RRID:WB-STRAIN:WBStrain00027347

http://www.wormbase.org/db/get?name=WBStrain00027347

Source Database: WormBase (WB)
Affected Genes: WBGene00003038(lin-56)
Genomic Alteration: WBGene00003038(lin-56)
Availability: available
Source References: EMPTY
Synonyms: lin-56(n2728) II.
Alternate IDs: WB-STRAIN:MT8842, CGC_MT8842
Notes: synMuv class A.

Proper citation: RRID:WB-STRAIN:WBStrain00027347 Copy   


  • RRID:WB-STRAIN:WBStrain00027420

http://www.wormbase.org/db/get?name=WBStrain00027420

Source Database: WormBase (WB)
Affected Genes: WBGene00003300(mir-72)
Genomic Alteration: WBGene00003300(mir-72)
Availability: available
Source References: EMPTY
Synonyms: mir-72(n4130) II.
Alternate IDs: WB-STRAIN:MT13015, CGC_MT13015
Notes: Deletion breakpoints are: CTCTCTGCGGAATTATATCAATTTTCT / ACCAATTCTATA...CAGGTCGAGCACTC / GGACTCCTTCTGTGAAGTGCACCTG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Made_by: Horvitz Lab Members"|"Mutagen:UV/TMP"

Proper citation: RRID:WB-STRAIN:WBStrain00027420 Copy   


  • RRID:WB-STRAIN:WBStrain00027416

http://www.wormbase.org/db/get?name=WBStrain00027416

Source Database: WormBase (WB)
Affected Genes: WBGene00003281(mir-53)
Genomic Alteration: WBGene00003281(mir-53)
Availability: available
Source References: EMPTY
Synonyms: mir-53(n4113) IV.
Alternate IDs: WB-STRAIN:MT12989, CGC_MT12989
Notes: Deletion breakpoints are: ACTCTATGATGTCCTTCAAAACAACA / TAATTTACGCCAT...CAGAATCGGGAGAAA / TTTATAATAATAGAGAGAGAGAGA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Made_by: Horvitz Lab Members"|"Mutagen:UV/TMP"

Proper citation: RRID:WB-STRAIN:WBStrain00027416 Copy   


  • RRID:WB-STRAIN:WBStrain00027411

http://www.wormbase.org/db/get?name=WBStrain00027411

Source Database: WormBase (WB)
Affected Genes: WBGene00007030(epc-1)
Genomic Alteration: WBGene00007030(epc-1)
Availability: available
Source References: EMPTY
Synonyms: epc-1(n4076) III/eT1 (III;V).
Alternate IDs: WB-STRAIN:MT12960, CGC_MT12960
Notes: Heterozygotes are WT and segregate WT, Uncs, Ste/Mel, and dead eggs. The epc-1(n4076) deletion removes 886 nucleotides from the epc-1 locus (Y111B2A.11). Relative to the first nucleotide of the predicted initiator ATG, the deletion begins at about nt. 2014 and ends at about nt. 2899 to give the junction sequence CTTCTCTGT/CCGGCTTTA.|"Mutagen:UV/TMP"

Proper citation: RRID:WB-STRAIN:WBStrain00027411 Copy   


  • RRID:WB-STRAIN:WBStrain00027494

http://www.wormbase.org/db/get?name=WBStrain00027494

Source Database: WormBase (WB)
Affected Genes: WBGene00008149(pyp-1)
Genomic Alteration: WBGene00008149(pyp-1)
Availability: available
Source References: EMPTY
Synonyms: pyp-1(n4599) IV/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:MT14910, CGC_MT14910
Notes: n4599: C47E12.4 deletion from AA12F3.

Proper citation: RRID:WB-STRAIN:WBStrain00027494 Copy   


  • RRID:WB-STRAIN:WBStrain00027495

http://www.wormbase.org/db/get?name=WBStrain00027495

Source Database: WormBase (WB)
Affected Genes: WBGene00016313(set-4)
Genomic Alteration: WBGene00016313(set-4)
Availability: available
Source References: EMPTY
Synonyms: set-4(n4600) II.
Alternate IDs: WB-STRAIN:MT14911, CGC_MT14911
Notes: C32D5.5 deletion allele.

Proper citation: RRID:WB-STRAIN:WBStrain00027495 Copy   


  • RRID:WB-STRAIN:WBStrain00027496

http://www.wormbase.org/db/get?name=WBStrain00027496

Source Database: WormBase (WB)
Affected Genes: WBGene00003354(mir-260)
Genomic Alteration: WBGene00003354(mir-260)
Availability: available
Source References: EMPTY
Synonyms: mir-260(n4601) II.
Alternate IDs: WB-STRAIN:MT14919, CGC_MT14919
Notes: Deletion breakpoints are:TTACTAAAAAAAAAGTGCCTAG / GATTGTCTGAAAATT...CGGCTGAAAAATAT / AAATTTATAACTGGGCAACAGAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects|"Deletion breakpoints are:TTACTAAAAAAAAAGTGCCTAG / GATTGTCTGAAAATT...CGGCTGAAAAATAT / AAATTTATAACTGGGCAACAGAAA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects"|"Made_by: Horvitz Lab"

Proper citation: RRID:WB-STRAIN:WBStrain00027496 Copy   


  • RRID:WB-STRAIN:WBStrain00027491

http://www.wormbase.org/db/get?name=WBStrain00027491

Source Database: WormBase (WB)
Affected Genes: WBGene00003355(mir-261)
Genomic Alteration: WBGene00003355(mir-261)
Availability: available
Source References: EMPTY
Synonyms: mir-261(n4594) II.
Alternate IDs: WB-STRAIN:MT14876, CGC_MT14876
Notes: Deletion breakpoints are:TTTTCGAATTGGCTTATG / AACCGATGGCATTTTCTTCTC...TGCAAATTGGGGCCAACA / ATACAATAGGTGTAAAATGGC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:TTTTCGAATTGGCTTATG / AACCGATGGCATTTTCTTCTC...TGCAAATTGGGGCCAACA / ATACAATAGGTGTAAAATGGC.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"

Proper citation: RRID:WB-STRAIN:WBStrain00027491 Copy   


  • RRID:WB-STRAIN:WBStrain00027492

http://www.wormbase.org/db/get?name=WBStrain00027492

Source Database: WormBase (WB)
Affected Genes: WBGene00003363(mir-270)
Genomic Alteration: WBGene00003363(mir-270)
Availability: available
Source References: EMPTY
Synonyms: mir-270(n4595) IV.
Alternate IDs: WB-STRAIN:MT14878, CGC_MT14878
Notes: Deletion breakpoints are:AGTTTGGAAAACTGTGCTAGAATGAGAAAAGTTGCTGAAATGAT / GAAAAAGCG...TCGGACTTTA / CCCTTCGCCCCTTATCACACCATTCTATCAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:AGTTTGGAAAACTGTGCTAGAATGAGAAAAGTTGCTGAAATGAT / GAAAAAGCG...TCGGACTTTA / CCCTTCGCCCCTTATCACACCATTCTATCAA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"

Proper citation: RRID:WB-STRAIN:WBStrain00027492 Copy   


  • RRID:WB-STRAIN:WBStrain00027493

http://www.wormbase.org/db/get?name=WBStrain00027493

Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: nDf48 nDf49 II.
Alternate IDs: WB-STRAIN:MT14879, CGC_MT14879
Notes: Made_by: Ezequiel Alvarez-Saa|"Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73."

Proper citation: RRID:WB-STRAIN:WBStrain00027493 Copy   


  • RRID:WB-STRAIN:WBStrain00027407

http://www.wormbase.org/db/get?name=WBStrain00027407

Source Database: WormBase (WB)
Affected Genes: WBGene00003280(mir-52)
Genomic Alteration: WBGene00003280(mir-52)
Availability: available
Source References: EMPTY
Synonyms: mir-52(n4100) IV.
Alternate IDs: WB-STRAIN:MT12945, CGC_MT12945
Notes: Deletion breakpoints are: CTACTCCTACAACTACAACTAC / TACTACTACTATA...ATCACGTTTAAATCA / ATTTCCCAAGAGTTTTCGTATAAT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Made_by: Horvitz Lab Members"|"Mutagen:UV/TMP"

Proper citation: RRID:WB-STRAIN:WBStrain00027407 Copy   


  • RRID:WB-STRAIN:WBStrain00027409

http://www.wormbase.org/db/get?name=WBStrain00027409

Source Database: WormBase (WB)
Affected Genes: WBGene00003260(mir-1)
Genomic Alteration: WBGene00003260(mir-1)
Availability: available
Source References: EMPTY
Synonyms: mir-1(n4102) I.
Alternate IDs: WB-STRAIN:MT12955, CGC_MT12955
Notes: Deletion breakpoints are:CGTCAGAAGGGCGCCTTTTCCTTCG / CCTTGCCGCATCG...CGTCATTGCCGTC / TTAACAGGCATCGAATGGAAAAATTGGCG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Deletion breakpoints are:CGTCAGAAGGGCGCCTTTTCCTTCG / CCTTGCCGCATCG...CGTCATTGCCGTC / TTAACAGGCATCGAATGGAAAAATTGGCG.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"Made_by: Horvitz Lab"|"Mutagen:UV/TMP"

Proper citation: RRID:WB-STRAIN:WBStrain00027409 Copy   


  • RRID:WB-STRAIN:WBStrain00027403

http://www.wormbase.org/db/get?name=WBStrain00027403

Source Database: WormBase (WB)
Affected Genes: WBGene00003041(lin-61)|WBGene00013006(lin-38)
Genomic Alteration: WBGene00003041(lin-61), WBGene00013006(lin-38)
Availability: available
Source References: EMPTY
Synonyms: lin-61(n3809) I; lin-38(n751) II.
Alternate IDs: WB-STRAIN:MT12836, CGC_MT12836
Notes: SynMuv. Reference: Andersen EC, et al. Genetics. 2008 Aug;179(4):2001-12. Harrison MM, et al. Genetics. 2007 May;176(1):255-71.

Proper citation: RRID:WB-STRAIN:WBStrain00027403 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X