Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Availability:available (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

147,344 Results - per page

Show More Columns | Download Top 1000 Results

Organism Name Proper Citation Species Synonyms Notes Phenotype Affected Gene Genomic Alteration Catalog Number Background Database Database Abbreviation Availability Source References Alternate IDs Record Last Update Mentions Count
EG4813
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00006699 Caenorhabditis elegans lin-15B&lin-15A(n765) X; oxEx1088. oxEx1088 [unc-17p::halorhodopsin::GFP + Litmus + lin-15(+)]. Maintain by picking wild-type. WBGene00023497(lin-15B)|WBGene00023498(lin-15A) WBGene00023497(lin-15B), WBGene00023498(lin-15A) WB-STRAIN:WBStrain00006699 WormBase (WB) WB available WB-STRAIN:EG4813, CGC_EG4813 2026-09-19 11:00:55 0
EG4725
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00006698 Caenorhabditis elegans Caenorhabditis elegans wild isolate. Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90.|"WBStrain provided so WBPaper00061063 paper added based on AFP_Strain data." WB-STRAIN:WBStrain00006698 WormBase (WB) WB available PMID:22301316
PMID:33593818
PMID:33820969
PMID:38564369
PMID:39303031
PMID:39853894
WB-STRAIN:EG4725, CGC_EG4725 2026-09-19 11:00:55 2
ED3041
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00006630 Caenorhabditis elegans Caenorhabditis elegans wild isolate. Added Wild_Isolate tag as genotype info suggesting that they were sampled from the wild.|"Caenorhabditis elegans wild isolate. Isolated near Ceres, South Africa, on April 2, 2006. Lat: -33.3667; Lon: 19.31667. Haplotype (according to Cutter 2006 and Dolgin et al 2008): beta."|"Made_by: A Cutter & E Dolgin" WB-STRAIN:WBStrain00006630 WormBase (WB) WB available WB-STRAIN:ED3041, CGC_ED3041 2026-09-19 11:00:54 0
ED3024
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00006627 Caenorhabditis elegans Caenorhabditis elegans wild isolate. Caenorhabditis elegans wild isolate. Isolated from a compost bin from a Midmar Allotment public vegetable garden (field 2 plot 43) near Edinburgh Scotland on Dec. 19, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): A.|"Made_by: A. Cutter/E. Dolgin" WB-STRAIN:WBStrain00006627 WormBase (WB) WB available WB-STRAIN:ED3024, CGC_ED3024 2026-09-19 11:00:54 0
ED3017
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00006622 Caenorhabditis elegans Caenorhabditis elegans wild isolate. Caenorhabditis elegans wild isolate. Isolated from a compost bin from a Midmar Allotment public vegetable garden (field 1 plot 39) near Edinburgh Scotland on Dec. 19, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): N.|"Made_by: A. Cutter/E. Dolgin" WB-STRAIN:WBStrain00006622 WormBase (WB) WB available PMID:22301316
PMID:33820969
PMID:38564369
WB-STRAIN:ED3017, CGC_ED3017 2026-09-19 11:00:54 1
ED3053
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00006641 Caenorhabditis elegans Caenorhabditis elegans wild isolate. Added Wild_Isolate tag as genotype info suggesting that they were sampled from the wild.|"Caenorhabditis elegans wild isolate. Isolated near Limuru, Kenya, on May 17, 2006. Lat: -1.08333; Lon: 36.65. Haplotype (according to Cutter 2006 and Dolgin et al 2008): epsilon."|"Made_by: A Cutter & E Dolgin" WB-STRAIN:WBStrain00006641 WormBase (WB) WB available WB-STRAIN:ED3053, CGC_ED3053 2026-09-19 11:00:55 0
ED3052
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00006640 Caenorhabditis elegans Caenorhabditis elegans wild isolate. Caenorhabditis elegans wild isolate. Isolated from compost at a plant nursery at the Ceres Fruit Farms in the Western Cape province near Ceres, South Africa, on May 5, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): delta.|"Made_by: E. Dolgin"|"Supplementary_genotype" WB-STRAIN:WBStrain00006640 WormBase (WB) WB available PMID:22301316
PMID:33820969
PMID:37008729
PMID:37572357
PMID:38564369
WB-STRAIN:ED3052, CGC_ED3052 2026-09-19 11:00:55 1
ED3049
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00006637 Caenorhabditis elegans Caenorhabditis elegans wild isolate. Made_by: E. Dolgin|"Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90." WB-STRAIN:WBStrain00006637 WormBase (WB) WB available PMID:22301316
PMID:32857789
PMID:33820969
PMID:37008729
PMID:38564369
WB-STRAIN:ED3049, CGC_ED3049 2026-09-19 11:00:54 0
ED3046
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00006635 Caenorhabditis elegans Caenorhabditis elegans wild isolate. Caenorhabditis elegans wild isolate. Isolated from compost at a plant nursery at the Ceres Fruit Farms in the Western Cape province near Ceres, South Africa, on May 5, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): gamma.|"Made_by: E. Dolgin" WB-STRAIN:WBStrain00006635 WormBase (WB) WB available PMID:32857789
PMID:33820969
PMID:38564369
WB-STRAIN:ED3046, CGC_ED3046 2026-09-19 11:00:54 1
ED3043
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00006632 Caenorhabditis elegans Caenorhabditis elegans wild isolate. Caenorhabditis elegans wild isolate. Isolated near Ceres, South Africa, on April 2, 2006. Lat: -33.3667; Lon: 19.31667. Haplotype (according to Cutter 2006 and Dolgin et al 2008): beta.|"Made_by: A Cutter & E Dolgin" WB-STRAIN:WBStrain00006632 WormBase (WB) WB available WB-STRAIN:ED3043, CGC_ED3043 2026-09-19 11:00:54 0
EE67
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00006652 Caenorhabditis elegans him-8(e1489) IV; mup-2(e2346) X. Made_by: Thierry Bogeart|"Temperature sensitive. At 15C the animals are essentially WT, but with a reduced brood; males mate well. Embryos raised at 25C will result in 3-fold/L1 arrest (Mup). Larval shift to 25C will result in sterile hermaphrodites but males that are fertile." WBGene00001867(him-8)|WBGene00003495(mup-2) WBGene00001867(him-8), WBGene00003495(mup-2) WB-STRAIN:WBStrain00006652 WormBase (WB) WB available PMID:8601585 WB-STRAIN:EE67, CGC_EE67 2026-09-19 11:00:55 0
ED3077
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00006649 Caenorhabditis elegans Caenorhabditis elegans wild isolate. Caenorhabditis elegans wild isolate. Isolated from leaf litter from the Uhuru Gardens public park in the south part of Nairobi, Kenya on May 17, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): beta.|"Made_by: E. Dolgin" WB-STRAIN:WBStrain00006649 WormBase (WB) WB available PMID:22301316
PMID:33820969
PMID:38564369
WB-STRAIN:ED3077, CGC_ED3077 2026-09-19 11:00:55 0
ED3073
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00006646 Caenorhabditis elegans Caenorhabditis elegans wild isolate. Made_by: E. Dolgin|"Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90." WB-STRAIN:WBStrain00006646 WormBase (WB) WB available PMID:22301316
PMID:33820969
PMID:38564369
WB-STRAIN:ED3073, CGC_ED3073 2026-09-19 11:00:55 0
ED3072
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00006645 Caenorhabditis elegans Caenorhabditis elegans wild isolate. Caenorhabditis elegans wild isolate. Isolated from compost from the Olive Mushroom Farms near the town of Limuru, Kenya on May 17, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): epsilon.|"Made_by: E. Dolgin"|"Supplementary_genotype" WB-STRAIN:WBStrain00006645 WormBase (WB) WB available PMID:37572357 WB-STRAIN:ED3072, CGC_ED3072 2026-09-19 11:00:55 0
ED3071
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00006644 Caenorhabditis elegans Caenorhabditis elegans wild isolate. Added Wild_Isolate tag as genotype info suggesting that they were sampled from the wild.|"Caenorhabditis elegans wild isolate. Isolated near Limuru, Kenya, on May 17, 2006. Lat: -1.08333; Lon: 36.65. Haplotype (according to Cutter 2006 and Dolgin et al 2008): epsilon."|"Made_by: A Cutter & E Dolgin" WB-STRAIN:WBStrain00006644 WormBase (WB) WB available WB-STRAIN:ED3071, CGC_ED3071 2026-09-19 11:00:55 0
EG276
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00006661 Caenorhabditis elegans exp-1(ox276) II. Maintain under normal conditions. Reference: Beg AA & Jorgensen EM, Nat Neurosci. 2003 Nov;6(11):1145-52. WBGene00001373(exp-1) WBGene00001373(exp-1) WB-STRAIN:WBStrain00006661 WormBase (WB) WB available WB-STRAIN:EG276, CGC_EG276 2026-09-19 11:00:55 2
EG199
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00006660 Caenorhabditis elegans nas-37(ox199) X. At each molt the cuticle fails to open sufficiently at the anterior end and the partially shed cuticle is dragged behind the animal. Nucleotide change: substitution [c/t]. Flanking sequences: TTGTGGAGGATGCGGAACTAAAACC[c/t]GAGTTAGAGCATGCTACGGTGGAAA. WBGene00003553(nas-37) WBGene00003553(nas-37) WB-STRAIN:WBStrain00006660 WormBase (WB) WB available PMID:38177158 WB-STRAIN:EG199, CGC_EG199 2026-09-19 11:00:55 1
EG144
 
Resource Report
Resource Website
1+ mentions
RRID:WB-STRAIN:WBStrain00006659 Caenorhabditis elegans inx-16(ox144) I. Pax, Dec-slow (34 defecation cycle). Maintain uder normal conditions. Reference: Peters MA, et al. Curr Biol. 2007 Sep 18;17(18):1601-8. WBGene00002138(inx-16) WBGene00002138(inx-16) WB-STRAIN:WBStrain00006659 WormBase (WB) WB available WB-STRAIN:EG144, CGC_EG144 2026-09-19 11:00:55 2
EG4
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00006657 Caenorhabditis elegans pbo-5(ox4) V. Abnormal posterior body muscle contractions during defecation. Derived by single outcrossing of MT1733; allelic to n2303.|"Made_by: Paola DaSanta" WBGene00012857(pbo-5) WBGene00012857(pbo-5) WB-STRAIN:WBStrain00006657 WormBase (WB) WB available WB-STRAIN:EG4, CGC_EG4 2026-09-19 11:00:55 0
EG2288
 
Resource Report
Resource Website
RRID:WB-STRAIN:WBStrain00006674 Caenorhabditis elegans lin-15B&lin-15A(n765) X; oxEx110. oxEx110 [unc-49c::GFP + lin-15(+)]. Maintain by picking non-Muv. WBGene00023497(lin-15B)|WBGene00023498(lin-15A) WBGene00023497(lin-15B), WBGene00023498(lin-15A) WB-STRAIN:WBStrain00006674 WormBase (WB) WB available WB-STRAIN:EG2288, CGC_EG2288 2026-09-19 11:00:55 0

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.