Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
EG4813 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00006699 | Caenorhabditis elegans | lin-15B&lin-15A(n765) X; oxEx1088. | oxEx1088 [unc-17p::halorhodopsin::GFP + Litmus + lin-15(+)]. Maintain by picking wild-type. | WBGene00023497(lin-15B)|WBGene00023498(lin-15A) | WBGene00023497(lin-15B), WBGene00023498(lin-15A) | WB-STRAIN:WBStrain00006699 | WormBase (WB) | WB | available | WB-STRAIN:EG4813, CGC_EG4813 | 2026-09-19 11:00:55 | 0 | |||
|
EG4725 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00006698 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90.|"WBStrain provided so WBPaper00061063 paper added based on AFP_Strain data." | WB-STRAIN:WBStrain00006698 | WormBase (WB) | WB | available | PMID:22301316 PMID:33593818 PMID:33820969 PMID:38564369 PMID:39303031 PMID:39853894 |
WB-STRAIN:EG4725, CGC_EG4725 | 2026-09-19 11:00:55 | 2 | ||||
|
ED3041 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00006630 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | Added Wild_Isolate tag as genotype info suggesting that they were sampled from the wild.|"Caenorhabditis elegans wild isolate. Isolated near Ceres, South Africa, on April 2, 2006. Lat: -33.3667; Lon: 19.31667. Haplotype (according to Cutter 2006 and Dolgin et al 2008): beta."|"Made_by: A Cutter & E Dolgin" | WB-STRAIN:WBStrain00006630 | WormBase (WB) | WB | available | WB-STRAIN:ED3041, CGC_ED3041 | 2026-09-19 11:00:54 | 0 | |||||
|
ED3024 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00006627 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | Caenorhabditis elegans wild isolate. Isolated from a compost bin from a Midmar Allotment public vegetable garden (field 2 plot 43) near Edinburgh Scotland on Dec. 19, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): A.|"Made_by: A. Cutter/E. Dolgin" | WB-STRAIN:WBStrain00006627 | WormBase (WB) | WB | available | WB-STRAIN:ED3024, CGC_ED3024 | 2026-09-19 11:00:54 | 0 | |||||
|
ED3017 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00006622 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | Caenorhabditis elegans wild isolate. Isolated from a compost bin from a Midmar Allotment public vegetable garden (field 1 plot 39) near Edinburgh Scotland on Dec. 19, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): N.|"Made_by: A. Cutter/E. Dolgin" | WB-STRAIN:WBStrain00006622 | WormBase (WB) | WB | available | PMID:22301316 PMID:33820969 PMID:38564369 |
WB-STRAIN:ED3017, CGC_ED3017 | 2026-09-19 11:00:54 | 1 | ||||
|
ED3053 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00006641 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | Added Wild_Isolate tag as genotype info suggesting that they were sampled from the wild.|"Caenorhabditis elegans wild isolate. Isolated near Limuru, Kenya, on May 17, 2006. Lat: -1.08333; Lon: 36.65. Haplotype (according to Cutter 2006 and Dolgin et al 2008): epsilon."|"Made_by: A Cutter & E Dolgin" | WB-STRAIN:WBStrain00006641 | WormBase (WB) | WB | available | WB-STRAIN:ED3053, CGC_ED3053 | 2026-09-19 11:00:55 | 0 | |||||
|
ED3052 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00006640 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | Caenorhabditis elegans wild isolate. Isolated from compost at a plant nursery at the Ceres Fruit Farms in the Western Cape province near Ceres, South Africa, on May 5, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): delta.|"Made_by: E. Dolgin"|"Supplementary_genotype" | WB-STRAIN:WBStrain00006640 | WormBase (WB) | WB | available | PMID:22301316 PMID:33820969 PMID:37008729 PMID:37572357 PMID:38564369 |
WB-STRAIN:ED3052, CGC_ED3052 | 2026-09-19 11:00:55 | 1 | ||||
|
ED3049 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00006637 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | Made_by: E. Dolgin|"Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90." | WB-STRAIN:WBStrain00006637 | WormBase (WB) | WB | available | PMID:22301316 PMID:32857789 PMID:33820969 PMID:37008729 PMID:38564369 |
WB-STRAIN:ED3049, CGC_ED3049 | 2026-09-19 11:00:54 | 0 | ||||
|
ED3046 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00006635 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | Caenorhabditis elegans wild isolate. Isolated from compost at a plant nursery at the Ceres Fruit Farms in the Western Cape province near Ceres, South Africa, on May 5, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): gamma.|"Made_by: E. Dolgin" | WB-STRAIN:WBStrain00006635 | WormBase (WB) | WB | available | PMID:32857789 PMID:33820969 PMID:38564369 |
WB-STRAIN:ED3046, CGC_ED3046 | 2026-09-19 11:00:54 | 1 | ||||
|
ED3043 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00006632 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | Caenorhabditis elegans wild isolate. Isolated near Ceres, South Africa, on April 2, 2006. Lat: -33.3667; Lon: 19.31667. Haplotype (according to Cutter 2006 and Dolgin et al 2008): beta.|"Made_by: A Cutter & E Dolgin" | WB-STRAIN:WBStrain00006632 | WormBase (WB) | WB | available | WB-STRAIN:ED3043, CGC_ED3043 | 2026-09-19 11:00:54 | 0 | |||||
|
EE67 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00006652 | Caenorhabditis elegans | him-8(e1489) IV; mup-2(e2346) X. | Made_by: Thierry Bogeart|"Temperature sensitive. At 15C the animals are essentially WT, but with a reduced brood; males mate well. Embryos raised at 25C will result in 3-fold/L1 arrest (Mup). Larval shift to 25C will result in sterile hermaphrodites but males that are fertile." | WBGene00001867(him-8)|WBGene00003495(mup-2) | WBGene00001867(him-8), WBGene00003495(mup-2) | WB-STRAIN:WBStrain00006652 | WormBase (WB) | WB | available | PMID:8601585 | WB-STRAIN:EE67, CGC_EE67 | 2026-09-19 11:00:55 | 0 | ||
|
ED3077 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00006649 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | Caenorhabditis elegans wild isolate. Isolated from leaf litter from the Uhuru Gardens public park in the south part of Nairobi, Kenya on May 17, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): beta.|"Made_by: E. Dolgin" | WB-STRAIN:WBStrain00006649 | WormBase (WB) | WB | available | PMID:22301316 PMID:33820969 PMID:38564369 |
WB-STRAIN:ED3077, CGC_ED3077 | 2026-09-19 11:00:55 | 0 | ||||
|
ED3073 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00006646 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | Made_by: E. Dolgin|"Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90." | WB-STRAIN:WBStrain00006646 | WormBase (WB) | WB | available | PMID:22301316 PMID:33820969 PMID:38564369 |
WB-STRAIN:ED3073, CGC_ED3073 | 2026-09-19 11:00:55 | 0 | ||||
|
ED3072 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00006645 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | Caenorhabditis elegans wild isolate. Isolated from compost from the Olive Mushroom Farms near the town of Limuru, Kenya on May 17, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): epsilon.|"Made_by: E. Dolgin"|"Supplementary_genotype" | WB-STRAIN:WBStrain00006645 | WormBase (WB) | WB | available | PMID:37572357 | WB-STRAIN:ED3072, CGC_ED3072 | 2026-09-19 11:00:55 | 0 | ||||
|
ED3071 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00006644 | Caenorhabditis elegans | Caenorhabditis elegans wild isolate. | Added Wild_Isolate tag as genotype info suggesting that they were sampled from the wild.|"Caenorhabditis elegans wild isolate. Isolated near Limuru, Kenya, on May 17, 2006. Lat: -1.08333; Lon: 36.65. Haplotype (according to Cutter 2006 and Dolgin et al 2008): epsilon."|"Made_by: A Cutter & E Dolgin" | WB-STRAIN:WBStrain00006644 | WormBase (WB) | WB | available | WB-STRAIN:ED3071, CGC_ED3071 | 2026-09-19 11:00:55 | 0 | |||||
|
EG276 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00006661 | Caenorhabditis elegans | exp-1(ox276) II. | Maintain under normal conditions. Reference: Beg AA & Jorgensen EM, Nat Neurosci. 2003 Nov;6(11):1145-52. | WBGene00001373(exp-1) | WBGene00001373(exp-1) | WB-STRAIN:WBStrain00006661 | WormBase (WB) | WB | available | WB-STRAIN:EG276, CGC_EG276 | 2026-09-19 11:00:55 | 2 | |||
|
EG199 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00006660 | Caenorhabditis elegans | nas-37(ox199) X. | At each molt the cuticle fails to open sufficiently at the anterior end and the partially shed cuticle is dragged behind the animal. Nucleotide change: substitution [c/t]. Flanking sequences: TTGTGGAGGATGCGGAACTAAAACC[c/t]GAGTTAGAGCATGCTACGGTGGAAA. | WBGene00003553(nas-37) | WBGene00003553(nas-37) | WB-STRAIN:WBStrain00006660 | WormBase (WB) | WB | available | PMID:38177158 | WB-STRAIN:EG199, CGC_EG199 | 2026-09-19 11:00:55 | 1 | ||
|
EG144 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00006659 | Caenorhabditis elegans | inx-16(ox144) I. | Pax, Dec-slow (34 defecation cycle). Maintain uder normal conditions. Reference: Peters MA, et al. Curr Biol. 2007 Sep 18;17(18):1601-8. | WBGene00002138(inx-16) | WBGene00002138(inx-16) | WB-STRAIN:WBStrain00006659 | WormBase (WB) | WB | available | WB-STRAIN:EG144, CGC_EG144 | 2026-09-19 11:00:55 | 2 | |||
|
EG4 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00006657 | Caenorhabditis elegans | pbo-5(ox4) V. | Abnormal posterior body muscle contractions during defecation. Derived by single outcrossing of MT1733; allelic to n2303.|"Made_by: Paola DaSanta" | WBGene00012857(pbo-5) | WBGene00012857(pbo-5) | WB-STRAIN:WBStrain00006657 | WormBase (WB) | WB | available | WB-STRAIN:EG4, CGC_EG4 | 2026-09-19 11:00:55 | 0 | |||
|
EG2288 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00006674 | Caenorhabditis elegans | lin-15B&lin-15A(n765) X; oxEx110. | oxEx110 [unc-49c::GFP + lin-15(+)]. Maintain by picking non-Muv. | WBGene00023497(lin-15B)|WBGene00023498(lin-15A) | WBGene00023497(lin-15B), WBGene00023498(lin-15A) | WB-STRAIN:WBStrain00006674 | WormBase (WB) | WB | available | WB-STRAIN:EG2288, CGC_EG2288 | 2026-09-19 11:00:55 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.