Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00007156
Source Database: WormBase (WB)
Affected Genes: WBGene00000611(col-34)|WBGene00001864(him-5)
Genomic Alteration: WBGene00000611(col-34), WBGene00001864(him-5)
Availability: available
Source References: EMPTY
Synonyms: col-34(bx25) IV; him-5(e1490) V.
Alternate IDs: WB-STRAIN:EM68, CGC_EM68
Notes: Lumpy rays. Temperature sensitive. bx25 previously called ram-4.|"Made_by: Baird S"
Proper citation: RRID:WB-STRAIN:WBStrain00007156 Copy
http://www.wormbase.org/db/get?name=WBStrain00007155
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00003111(mab-20)
Genomic Alteration: WBGene00001864(him-5), WBGene00003111(mab-20)
Availability: available
Source References: PMID:1782863
Synonyms: mab-20(bx24) I; him-5(e1490) V.
Alternate IDs: WB-STRAIN:EM67, CGC_EM67
Notes: Extensive ray fusion. Posterior portion of body swollen at larval stages.
Proper citation: RRID:WB-STRAIN:WBStrain00007155 Copy
http://www.wormbase.org/db/get?name=WBStrain00007153
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00003109(mab-17)|WBGene00006754(unc-15)
Genomic Alteration: WBGene00001864(him-5), WBGene00003109(mab-17), WBGene00006754(unc-15)
Availability: available
Source References: EMPTY
Synonyms: mab-17(e2167) unc-15(e73) I; him-5(e1490) V.
Alternate IDs: WB-STRAIN:EM62, CGC_EM62
Notes: Unc. Round bulging adult male tale. Very reduced fan. Mating efficiency is zero.
Proper citation: RRID:WB-STRAIN:WBStrain00007153 Copy
http://www.wormbase.org/db/get?name=WBStrain00007150
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00001077(dpy-18)|WBGene00001214(ego-1)|WBGene00006765(unc-29)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001077(dpy-18), WBGene00001214(ego-1), WBGene00006765(unc-29)
Availability: available
Source References: PMID:10704412
Synonyms: ego-1(om84) unc-29(e193)/hT2 [dpy-18(h662)] I; +/hT2 [bli-4(e937)] III.
Alternate IDs: WB-STRAIN:EL391, CGC_EL391
Notes: Heterozygotes are WT and segregate WT, mild Unc that are Sterile, and Dpys. bli-4 is suppressed by dpy-18 in hT2 homozygotes-only see a very few DpyBli.|"Made_by: Spoerke/Maine"
Proper citation: RRID:WB-STRAIN:WBStrain00007150 Copy
http://www.wormbase.org/db/get?name=WBStrain00007149
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00001077(dpy-18)|WBGene00001214(ego-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001077(dpy-18), WBGene00001214(ego-1)
Availability: available
Source References: EMPTY
Synonyms: ego-1(om58)/hT2 [dpy-18(h662)] I; +/hT2 [bli-4(e937)] III.
Alternate IDs: WB-STRAIN:EL329, CGC_EL329
Notes: Heterozgyotes are WT and segregate WT, Steriles and Dpys. The Steriles produce small, abnormal oocytes; some dead embryos are produced in late adulthood. bli-4 is suppressed by dpy-1 in hT2 homozygotes-only see a very few DpyBli. om58 previously called ego-6(om58).
Proper citation: RRID:WB-STRAIN:WBStrain00007149 Copy
http://www.wormbase.org/db/get?name=WBStrain00007168
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00004299(ram-1)
Genomic Alteration: WBGene00001864(him-5), WBGene00004299(ram-1)
Availability: available
Source References: EMPTY
Synonyms: ram-1(bx34) I; him-5(e1490) V.
Alternate IDs: WB-STRAIN:EM139, CGC_EM139
Notes: Lumpy rays.|"Made_by: Baird S"
Proper citation: RRID:WB-STRAIN:WBStrain00007168 Copy
http://www.wormbase.org/db/get?name=WBStrain00007201
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: (kr5273) X.
Alternate IDs: WB-STRAIN:EN5273, CGC_EN5273
Notes: Mos1 transposon insertion in LG X. Presence of Mos1 can be detected using oligos oJL115 (Mos1 5'gctcaattcgcgccaaactatg3') and oVR266 (Chr X 5'gacaaagacgtgtagttgcg3'). Reference: Giordano-Santini R, et al., (2010) Nature Methods. Aug 22.
Proper citation: RRID:WB-STRAIN:WBStrain00007201 Copy
http://www.wormbase.org/db/get?name=WBStrain00007165
Source Database: WormBase (WB)
Affected Genes: WBGene00001068(dpy-6)|WBGene00001864(him-5)|WBGene00006757(unc-18)
Genomic Alteration: WBGene00001068(dpy-6), WBGene00001864(him-5), WBGene00006757(unc-18)
Availability: available
Source References: PMID:6537930
Synonyms: stDp2 (X;II)/+ II; him-5(e1490) V; unc-18(e81) dpy-6(e14) X.
Alternate IDs: WB-STRAIN:EM122, CGC_EM122
Notes: Strain throws WT, DpyUncs and males (and some Lon-don't know where these come from??). Maintain by picking WT. non-Unc non-Dpy males mate at low frequency and will transmit stDp2.
Proper citation: RRID:WB-STRAIN:WBStrain00007165 Copy
http://www.wormbase.org/db/get?name=WBStrain00007164
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00003116(mab-25)
Genomic Alteration: WBGene00001864(him-5), WBGene00003116(mab-25)
Availability: available
Source References: EMPTY
Synonyms: mab-25(bx27) I; him-5(e1490) V.
Alternate IDs: WB-STRAIN:EM116, CGC_EM116
Notes: Temperature sensitive. Missing Ray. Swollen tail and reduced fan. Temperature sensitive lethal at all stages. Wrinkled spicule.
Proper citation: RRID:WB-STRAIN:WBStrain00007164 Copy
http://www.wormbase.org/db/get?name=WBStrain00007163
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00001864(him-5)|WBGene00004300(ram-2)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00001864(him-5), WBGene00004300(ram-2)
Availability: available
Source References: EMPTY
Synonyms: dpy-10(e128) ram-2(bx32) II; him-5(e1490) V.
Alternate IDs: WB-STRAIN:EM113, CGC_EM113
Notes: Dpy. Abnormal rays.|"Made_by: Baird S"
Proper citation: RRID:WB-STRAIN:WBStrain00007163 Copy
http://www.wormbase.org/db/get?name=WBStrain00007161
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00003026(lin-41)
Genomic Alteration: WBGene00001864(him-5), WBGene00003026(lin-41)
Availability: available
Source References: EMPTY
Synonyms: lin-41(bx42) I; him-5(e1490) V.
Alternate IDs: WB-STRAIN:EM106, CGC_EM106
Notes: Maintain under normal conditions. Males have long tail tips.
Proper citation: RRID:WB-STRAIN:WBStrain00007161 Copy
http://www.wormbase.org/db/get?name=WBStrain00007160
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00003112(mab-21)
Genomic Alteration: WBGene00001864(him-5), WBGene00003112(mab-21)
Availability: available
Source References: PMID:1782863
Synonyms: mab-21(bx41) III; him-5(e1490) V.
Alternate IDs: WB-STRAIN:EM105, CGC_EM105
Notes: Transformation of ray 6 to a thin ray which is anteriorly displaced and fuses with ray 4 (95%). A 10th ray is found in about 50% of the sides scored. Body is slightly shorter.
Proper citation: RRID:WB-STRAIN:WBStrain00007160 Copy
http://www.wormbase.org/db/get?name=WBStrain00007159
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00003026(lin-41)
Genomic Alteration: WBGene00001864(him-5), WBGene00003026(lin-41)
Availability: available
Source References: EMPTY
Synonyms: lin-41(bx37)I; him-5(e1490)V.
Alternate IDs: WB-STRAIN:EM101, CGC_EM101
Notes: Maintain under normal conditions. Males have long tail tips.
Proper citation: RRID:WB-STRAIN:WBStrain00007159 Copy
http://www.wormbase.org/db/get?name=WBStrain00007178
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00006580(tlp-1)
Genomic Alteration: WBGene00001864(him-5), WBGene00006580(tlp-1)
Availability: available
Source References: PMID:32078235
Synonyms: tlp-1(bx85) IV; him-5(e1490) V.
Alternate IDs: WB-STRAIN:EM347, CGC_EM347
Notes: Although hermaphrodites appear WT in other ways, there are some problems with T cell lineages (affecting the phasmids) and tail cell fusions. Variably Dyf. Male tail tip morphogenesis is also defective, resulting in blobby, leptoderan tails. Males are infertile due to an inability to properly copulate. tlp-1 encodes a nuclear protein with a single C2H2-type zinc finger domain and an N-terminal SPLALLA domain, similar to that of Sp1 transcription factors of vertebrates. The bx85 mutation involves a truncation of TLP-1 due to a frameshift caused by a 5-bp deletion.
Proper citation: RRID:WB-STRAIN:WBStrain00007178 Copy
http://www.wormbase.org/db/get?name=WBStrain00007175
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00003111(mab-20)
Genomic Alteration: WBGene00001864(him-5), WBGene00003111(mab-20)
Availability: available
Source References: PMID:1782863
Synonyms: mab-20(bx61) I; him-5(e1490) V.
Alternate IDs: WB-STRAIN:EM253, CGC_EM253
Notes: Ray 3 and 4 fusion >60% at non-permissive temp. Ray 1 and 2 fusion about 10% at non-permissive temp. ts period is around L3-L4.
Proper citation: RRID:WB-STRAIN:WBStrain00007175 Copy
http://www.wormbase.org/db/get?name=WBStrain00007174
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00006543(tbx-2)
Genomic Alteration: WBGene00001864(him-5), WBGene00006543(tbx-2)
Availability: available
Source References: EMPTY
Synonyms: tbx-2(bx59) III; him-5(e1490) V.
Alternate IDs: WB-STRAIN:EM207, CGC_EM207
Notes: Conditional lethal: inviable when grown at 25C. Wild type at 16C. Viable when grown at 20C; partial ray loss at 20C. Shifting males during ray assembly to non-permissive temperature results in ray loss. No lineage defect.
Proper citation: RRID:WB-STRAIN:WBStrain00007174 Copy
http://www.wormbase.org/db/get?name=WBStrain00007171
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00001864(him-5)|WBGene00004300(ram-2)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00001864(him-5), WBGene00004300(ram-2)
Availability: available
Source References: EMPTY
Synonyms: dpy-10(e128) ram-2(bx39) II; him-5(e1490) V.
Alternate IDs: WB-STRAIN:EM146, CGC_EM146
Notes: Dpy. Abnormal rays.|"Made_by: Baird S"
Proper citation: RRID:WB-STRAIN:WBStrain00007171 Copy
http://www.wormbase.org/db/get?name=WBStrain00007103
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)
Genomic Alteration: WBGene00001864(him-5)
Availability: available
Source References: EMPTY
Synonyms: oxSi255 I; oxTi81 him-5(e1490) V.
Alternate IDs: WB-STRAIN:EG8961, CGC_EG8961
Notes: oxSi255 [snt-1p::GFP + Cbr-unc-119(+)] I. Integration into ttTi4348 mosSCI site (I:-5.32). Pan-neuronal GFP expression visible under dissection microscope. oxTi81 [eft-3p::GFP::H2B::tbb-2 3'UTR + unc-18(+)] V. Nuclear, green fluorescence is broadly expressed (in most cells). Integration into chr.V: 1.21. Him. Combined fluorescent balancer strain for LG I and LG IV. Strain contains him-5(e1490) to generate males for crosses.
Proper citation: RRID:WB-STRAIN:WBStrain00007103 Copy
http://www.wormbase.org/db/get?name=WBStrain00007189
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00044992(rax-2)
Genomic Alteration: WBGene00001864(him-5), WBGene00044992(rax-2)
Availability: available
Source References: EMPTY
Synonyms: rax-2(bx131) III; bxIs14 him-5(e1490) V.
Alternate IDs: WB-STRAIN:EM886, CGC_EM886
Notes: bxIs14 [pkd-2::GFP + pdx-1]. Ray axon defective.
Proper citation: RRID:WB-STRAIN:WBStrain00007189 Copy
http://www.wormbase.org/db/get?name=WBStrain00007188
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00004945(sop-2)
Genomic Alteration: WBGene00001864(him-5), WBGene00004945(sop-2)
Availability: available
Source References: EMPTY
Synonyms: sop-2(bx91) II; him-5(e1490) V.
Alternate IDs: WB-STRAIN:EM723, CGC_EM723
Notes: Made_by: H. Zhang/S. Emmons|"Temperature sensitive. Early larval arrest at 25C. At 20C, Lon, PVul, Muv, Mog, ectopic Hox gene expression."
Proper citation: RRID:WB-STRAIN:WBStrain00007188 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
