Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 183 showing 3641 ~ 3660 out of 147,344 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:WB-STRAIN:WBStrain00006699

http://www.wormbase.org/db/get?name=WBStrain00006699

Source Database: WormBase (WB)
Affected Genes: WBGene00023497(lin-15B)|WBGene00023498(lin-15A)
Genomic Alteration: WBGene00023497(lin-15B), WBGene00023498(lin-15A)
Availability: available
Source References: EMPTY
Synonyms: lin-15B&lin-15A(n765) X; oxEx1088.
Alternate IDs: WB-STRAIN:EG4813, CGC_EG4813
Notes: oxEx1088 [unc-17p::halorhodopsin::GFP + Litmus + lin-15(+)]. Maintain by picking wild-type.

Proper citation: RRID:WB-STRAIN:WBStrain00006699 Copy   


  • RRID:WB-STRAIN:WBStrain00006698

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00006698

Source Database: WormBase (WB)
Availability: available
Source References: PMID:22301316, PMID:33593818, PMID:33820969, PMID:38564369, PMID:39303031, PMID:39853894
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:EG4725, CGC_EG4725
Notes: Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90.|"WBStrain provided so WBPaper00061063 paper added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00006698 Copy   


  • RRID:WB-STRAIN:WBStrain00006630

http://www.wormbase.org/db/get?name=WBStrain00006630

Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ED3041, CGC_ED3041
Notes: Added Wild_Isolate tag as genotype info suggesting that they were sampled from the wild.|"Caenorhabditis elegans wild isolate. Isolated near Ceres, South Africa, on April 2, 2006. Lat: -33.3667; Lon: 19.31667. Haplotype (according to Cutter 2006 and Dolgin et al 2008): beta."|"Made_by: A Cutter & E Dolgin"

Proper citation: RRID:WB-STRAIN:WBStrain00006630 Copy   


  • RRID:WB-STRAIN:WBStrain00006627

http://www.wormbase.org/db/get?name=WBStrain00006627

Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ED3024, CGC_ED3024
Notes: Caenorhabditis elegans wild isolate. Isolated from a compost bin from a Midmar Allotment public vegetable garden (field 2 plot 43) near Edinburgh Scotland on Dec. 19, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): A.|"Made_by: A. Cutter/E. Dolgin"

Proper citation: RRID:WB-STRAIN:WBStrain00006627 Copy   


  • RRID:WB-STRAIN:WBStrain00006622

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00006622

Source Database: WormBase (WB)
Availability: available
Source References: PMID:22301316, PMID:33820969, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ED3017, CGC_ED3017
Notes: Caenorhabditis elegans wild isolate. Isolated from a compost bin from a Midmar Allotment public vegetable garden (field 1 plot 39) near Edinburgh Scotland on Dec. 19, 2005. Haplotype (according to Cutter 2006 and Dolgin et al 2008): N.|"Made_by: A. Cutter/E. Dolgin"

Proper citation: RRID:WB-STRAIN:WBStrain00006622 Copy   


  • RRID:WB-STRAIN:WBStrain00006641

http://www.wormbase.org/db/get?name=WBStrain00006641

Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ED3053, CGC_ED3053
Notes: Added Wild_Isolate tag as genotype info suggesting that they were sampled from the wild.|"Caenorhabditis elegans wild isolate. Isolated near Limuru, Kenya, on May 17, 2006. Lat: -1.08333; Lon: 36.65. Haplotype (according to Cutter 2006 and Dolgin et al 2008): epsilon."|"Made_by: A Cutter & E Dolgin"

Proper citation: RRID:WB-STRAIN:WBStrain00006641 Copy   


  • RRID:WB-STRAIN:WBStrain00006640

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00006640

Source Database: WormBase (WB)
Availability: available
Source References: PMID:22301316, PMID:33820969, PMID:37008729, PMID:37572357, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ED3052, CGC_ED3052
Notes: Caenorhabditis elegans wild isolate. Isolated from compost at a plant nursery at the Ceres Fruit Farms in the Western Cape province near Ceres, South Africa, on May 5, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): delta.|"Made_by: E. Dolgin"|"Supplementary_genotype"

Proper citation: RRID:WB-STRAIN:WBStrain00006640 Copy   


  • RRID:WB-STRAIN:WBStrain00006637

http://www.wormbase.org/db/get?name=WBStrain00006637

Source Database: WormBase (WB)
Availability: available
Source References: PMID:22301316, PMID:32857789, PMID:33820969, PMID:37008729, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ED3049, CGC_ED3049
Notes: Made_by: E. Dolgin|"Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90."

Proper citation: RRID:WB-STRAIN:WBStrain00006637 Copy   


  • RRID:WB-STRAIN:WBStrain00006635

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00006635

Source Database: WormBase (WB)
Availability: available
Source References: PMID:32857789, PMID:33820969, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ED3046, CGC_ED3046
Notes: Caenorhabditis elegans wild isolate. Isolated from compost at a plant nursery at the Ceres Fruit Farms in the Western Cape province near Ceres, South Africa, on May 5, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): gamma.|"Made_by: E. Dolgin"

Proper citation: RRID:WB-STRAIN:WBStrain00006635 Copy   


  • RRID:WB-STRAIN:WBStrain00006632

http://www.wormbase.org/db/get?name=WBStrain00006632

Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ED3043, CGC_ED3043
Notes: Caenorhabditis elegans wild isolate. Isolated near Ceres, South Africa, on April 2, 2006. Lat: -33.3667; Lon: 19.31667. Haplotype (according to Cutter 2006 and Dolgin et al 2008): beta.|"Made_by: A Cutter & E Dolgin"

Proper citation: RRID:WB-STRAIN:WBStrain00006632 Copy   


  • RRID:WB-STRAIN:WBStrain00006652

http://www.wormbase.org/db/get?name=WBStrain00006652

Source Database: WormBase (WB)
Affected Genes: WBGene00001867(him-8)|WBGene00003495(mup-2)
Genomic Alteration: WBGene00001867(him-8), WBGene00003495(mup-2)
Availability: available
Source References: PMID:8601585
Synonyms: him-8(e1489) IV; mup-2(e2346) X.
Alternate IDs: WB-STRAIN:EE67, CGC_EE67
Notes: Made_by: Thierry Bogeart|"Temperature sensitive. At 15C the animals are essentially WT, but with a reduced brood; males mate well. Embryos raised at 25C will result in 3-fold/L1 arrest (Mup). Larval shift to 25C will result in sterile hermaphrodites but males that are fertile."

Proper citation: RRID:WB-STRAIN:WBStrain00006652 Copy   


  • RRID:WB-STRAIN:WBStrain00006649

http://www.wormbase.org/db/get?name=WBStrain00006649

Source Database: WormBase (WB)
Availability: available
Source References: PMID:22301316, PMID:33820969, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ED3077, CGC_ED3077
Notes: Caenorhabditis elegans wild isolate. Isolated from leaf litter from the Uhuru Gardens public park in the south part of Nairobi, Kenya on May 17, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): beta.|"Made_by: E. Dolgin"

Proper citation: RRID:WB-STRAIN:WBStrain00006649 Copy   


  • RRID:WB-STRAIN:WBStrain00006646

http://www.wormbase.org/db/get?name=WBStrain00006646

Source Database: WormBase (WB)
Availability: available
Source References: PMID:22301316, PMID:33820969, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ED3073, CGC_ED3073
Notes: Made_by: E. Dolgin|"Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90."

Proper citation: RRID:WB-STRAIN:WBStrain00006646 Copy   


  • RRID:WB-STRAIN:WBStrain00006645

http://www.wormbase.org/db/get?name=WBStrain00006645

Source Database: WormBase (WB)
Availability: available
Source References: PMID:37572357
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ED3072, CGC_ED3072
Notes: Caenorhabditis elegans wild isolate. Isolated from compost from the Olive Mushroom Farms near the town of Limuru, Kenya on May 17, 2006. Haplotype (according to Cutter 2006 and Dolgin et al 2008): epsilon.|"Made_by: E. Dolgin"|"Supplementary_genotype"

Proper citation: RRID:WB-STRAIN:WBStrain00006645 Copy   


  • RRID:WB-STRAIN:WBStrain00006644

http://www.wormbase.org/db/get?name=WBStrain00006644

Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ED3071, CGC_ED3071
Notes: Added Wild_Isolate tag as genotype info suggesting that they were sampled from the wild.|"Caenorhabditis elegans wild isolate. Isolated near Limuru, Kenya, on May 17, 2006. Lat: -1.08333; Lon: 36.65. Haplotype (according to Cutter 2006 and Dolgin et al 2008): epsilon."|"Made_by: A Cutter & E Dolgin"

Proper citation: RRID:WB-STRAIN:WBStrain00006644 Copy   


  • RRID:WB-STRAIN:WBStrain00006661

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00006661

Source Database: WormBase (WB)
Affected Genes: WBGene00001373(exp-1)
Genomic Alteration: WBGene00001373(exp-1)
Availability: available
Source References: EMPTY
Synonyms: exp-1(ox276) II.
Alternate IDs: WB-STRAIN:EG276, CGC_EG276
Notes: Maintain under normal conditions. Reference: Beg AA & Jorgensen EM, Nat Neurosci. 2003 Nov;6(11):1145-52.

Proper citation: RRID:WB-STRAIN:WBStrain00006661 Copy   


  • RRID:WB-STRAIN:WBStrain00006660

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00006660

Source Database: WormBase (WB)
Affected Genes: WBGene00003553(nas-37)
Genomic Alteration: WBGene00003553(nas-37)
Availability: available
Source References: PMID:38177158
Synonyms: nas-37(ox199) X.
Alternate IDs: WB-STRAIN:EG199, CGC_EG199
Notes: At each molt the cuticle fails to open sufficiently at the anterior end and the partially shed cuticle is dragged behind the animal. Nucleotide change: substitution [c/t]. Flanking sequences: TTGTGGAGGATGCGGAACTAAAACC[c/t]GAGTTAGAGCATGCTACGGTGGAAA.

Proper citation: RRID:WB-STRAIN:WBStrain00006660 Copy   


  • RRID:WB-STRAIN:WBStrain00006659

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00006659

Source Database: WormBase (WB)
Affected Genes: WBGene00002138(inx-16)
Genomic Alteration: WBGene00002138(inx-16)
Availability: available
Source References: EMPTY
Synonyms: inx-16(ox144) I.
Alternate IDs: WB-STRAIN:EG144, CGC_EG144
Notes: Pax, Dec-slow (34 defecation cycle). Maintain uder normal conditions. Reference: Peters MA, et al. Curr Biol. 2007 Sep 18;17(18):1601-8.

Proper citation: RRID:WB-STRAIN:WBStrain00006659 Copy   


  • RRID:WB-STRAIN:WBStrain00006657

http://www.wormbase.org/db/get?name=WBStrain00006657

Source Database: WormBase (WB)
Affected Genes: WBGene00012857(pbo-5)
Genomic Alteration: WBGene00012857(pbo-5)
Availability: available
Source References: EMPTY
Synonyms: pbo-5(ox4) V.
Alternate IDs: WB-STRAIN:EG4, CGC_EG4
Notes: Abnormal posterior body muscle contractions during defecation. Derived by single outcrossing of MT1733; allelic to n2303.|"Made_by: Paola DaSanta"

Proper citation: RRID:WB-STRAIN:WBStrain00006657 Copy   


  • RRID:WB-STRAIN:WBStrain00006674

http://www.wormbase.org/db/get?name=WBStrain00006674

Source Database: WormBase (WB)
Affected Genes: WBGene00023497(lin-15B)|WBGene00023498(lin-15A)
Genomic Alteration: WBGene00023497(lin-15B), WBGene00023498(lin-15A)
Availability: available
Source References: EMPTY
Synonyms: lin-15B&lin-15A(n765) X; oxEx110.
Alternate IDs: WB-STRAIN:EG2288, CGC_EG2288
Notes: oxEx110 [unc-49c::GFP + lin-15(+)]. Maintain by picking non-Muv.

Proper citation: RRID:WB-STRAIN:WBStrain00006674 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X