Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
OP75 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029987 | Caenorhabditis elegans | unc-119(ed3) III; wgEx75. | Made_by: modEncode|"Modern strain"|"wgEx75 [elt-3::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (URL: www.modencode.org)"|"wgIs75 [elt-3::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (URL: www.modencode.org)" | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00029987 | WormBase (WB) | WB | available | WB-STRAIN:OP75, CGC_OP75 | 2026-09-12 11:16:05 | 0 | |||
|
OP74 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029986 | Caenorhabditis elegans | unc-119(ed3) III; wgIs74. | Made_by: modEncode|"wgIs74 [hlh-8::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (URL: www.modencode.org)" | WBGene00006843(unc-119) | WBGene00006843(unc-119) | WB-STRAIN:WBStrain00029986 | WormBase (WB) | WB | available | WB-STRAIN:OP74, CGC_OP74 | 2026-09-12 11:16:05 | 0 | |||
|
OK0029 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029938 | Caenorhabditis elegans | EMPTY | Retired following removal of zero padded strain public_names. | WBGene00000445(ceh-22) | WBGene00000445(ceh-22) | WB-STRAIN:WBStrain00029938 | WormBase (WB) | WB | unknown | WB-STRAIN:OK0029 | 2026-09-12 11:16:04 | 0 | |||
|
OH15732 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029934 | Caenorhabditis elegans | mab-3(ot931[mab-3::GFP::3xFlag]) II; him-5 (e1490) V. | GFP and 3xFlag tag inserted in endogenous mab-3 locus using the CRISPR SEC cassette (Dickinson 2015). sgRNA: ggtcaaaattatagatctt Insertion site: II: 9737290-9737291. Reference: Pereira L, et al. Elife. 2019 Jan 1;8. pii: e42078. doi: 10.7554/eLife.42078. | WBGene00001864(him-5)|WBGene00003100(mab-3) | WBGene00001864(him-5), WBGene00003100(mab-3) | WB-STRAIN:WBStrain00029934 | WormBase (WB) | WB | available | PMID:38880276 | WB-STRAIN:OH15732, CGC_OH15732 | 2026-09-12 11:16:04 | 0 | ||
|
OH15815 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029936 | Caenorhabditis elegans | che-1(ot63 ot941[che-1::SEC-GFP::TEV::3xFLAG]) I. | Made_by: Eduardo Leyva-Diaz|"ot941[che-1::SEC-GFP::TEV::3xFLAG]. Endogenous locus of che-1 carrying ot63 null alllele and tagged with GFP (che-1::SEC-GFP::TEV::3xFLAG). che-1(ot63) is a loss of function allele which carries a (Cys255Tyr) missense mutation in the fourth Zn finger domain of CHE-1. Reference: Chang S, et al. Genes Dev. 2003 Sep 1;17(17):2123-37." | WBGene00000483(che-1) | WBGene00000483(che-1) | WB-STRAIN:WBStrain00029936 | WormBase (WB) | WB | available | WB-STRAIN:OH15815, CGC_OH15815 | 2026-09-12 11:16:04 | 0 | |||
|
OH15733 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029935 | Caenorhabditis elegans | dmd-3(ot932[dmd-3::GFP::3xFlag]); him-8 (e1489) IV. | DMD-3::GFP endogenous tag|"GFP and 3xFlag tag inserted in endogenous dmd-3 locus using the CRISPR SEC cassette (Dickinson 2015). sgRNA: accctttcagccgtattgt Insertion site: V: 19650564-19650565. Reference: Pereira L, et al. Elife. 2019 Jan 1;8. pii: e42078. doi: 10.7554/eLife.42078." | WBGene00001867(him-8)|WBGene00012832(dmd-3) | WBGene00001867(him-8), WBGene00012832(dmd-3) | WB-STRAIN:WBStrain00029935 | WormBase (WB) | WB | available | PMID:37039075 | WB-STRAIN:OH15733, CGC_OH15733 | 2026-09-12 11:16:04 | 0 | ||
|
OH15568 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029931 | Caenorhabditis elegans | unc-17(ot907[unc-17::mKate2::3xflag]) IV. | Superficially wild-type. mKate2 and 3xFlag tag added to endogenous unc-17 locus. unc-17::mKate2 labels all cholinergic neurons in the nervous system. Reference: Pereira L, et al. Elife. 2019 Jan 1;8. pii: e42078. doi: 10.7554/eLife.42078. | WBGene00006756(unc-17) | WBGene00006756(unc-17) | WB-STRAIN:WBStrain00029931 | WormBase (WB) | WB | available | WB-STRAIN:OH15568, CGC_OH15568 | 2026-09-12 11:16:04 | 0 | |||
|
OH15179 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029927 | Caenorhabditis elegans | pals-22(ot811) III; otIs381 V | Made_by: Eduardo Leyva-Diaz|"otIs381 [ric-19p(prom6)::2xNLS::GFP + elt-2::DsRed] V. pals-22(ot811) mutant shows transgene-silencing phenotype. Pan-neuronal nuclear GFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. Leyva-Daz E, et al. Genetics (2017), 207(2):529-545." | WBGene00016216(pals-22) | WBGene00016216(pals-22) | WB-STRAIN:WBStrain00029927 | WormBase (WB) | WB | available | WB-STRAIN:OH15179, CGC_OH15179 | 2026-09-12 11:16:04 | 0 | |||
|
OH15178 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029926 | Caenorhabditis elegans | pals-22(ot810) III; otIs381 V. | Made_by: Eduardo Leyva-Diaz|"otIs381 [ric-19p(prom6)::2xNLS::GFP + elt-2::DsRed] V. Pan-neuronal nuclear GFP expression. pals-22(ot810) mutant shows transgene-silencing phenotype. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. Leyva-Daz E, et al. Genetics (2017), 207(2):529-545." | WBGene00016216(pals-22) | WBGene00016216(pals-22) | WB-STRAIN:WBStrain00029926 | WormBase (WB) | WB | available | WB-STRAIN:OH15178, CGC_OH15178 | 2026-09-12 11:16:04 | 0 | |||
|
OH15227 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029928 | Caenorhabditis elegans | unc-86(ot893[unc-86::3xFlag::mNeonGreen::AID]) III. | Made_by: Eduardo Leyva-Diaz|"unc-86(ot893) is a CRISPR/Cas9 engineered translational reporter (nuclear mNeonGreen expression). Endogenous unc-86 locus is tagged 3xFlag::mNeonGreen::AID (Auxin Inducible Degron) at the 3' end. The mNeonGreen::AID cassette was inserted right before the stop codon of the unc-86 locus, using a guide RNA that targets a sequence overlapping the unc-86 locus STOP codon (target sequence: GGATTCTTTGATTAGTTTCG). Reference: Serrano-Saiz E, (2018). BRN3-type POU homeobox genes maintain the identity of mature postmitotic neurons in nematodes and mice. Curr Biol (in press)." | WBGene00006818(unc-86) | WBGene00006818(unc-86) | WB-STRAIN:WBStrain00029928 | WormBase (WB) | WB | available | WB-STRAIN:OH15227, CGC_OH15227 | 2026-09-12 11:16:04 | 0 | |||
|
OH15128 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029922 | Caenorhabditis elegans | pha-1(e2123) III; him-5(e1490) V; otEx7020. | otEx7020 [srg-64p::GFP + pha-1(+)]. Maintain at 25C to select for transgenic array. Reference: Vidal B, et al. (2018) PLoS Biol 16(1): e2004218. | WBGene00001864(him-5)|WBGene00004010(pha-1) | WBGene00001864(him-5), WBGene00004010(pha-1) | WB-STRAIN:WBStrain00029922 | WormBase (WB) | WB | available | WB-STRAIN:OH15128, CGC_OH15128 | 2026-09-12 11:16:04 | 0 | |||
|
OH15144 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00029924 | Caenorhabditis elegans | pha-1(e2123) III; otEx7036. | Made_by: Eduardo Leyva-Diaz|"otEx7036 [pals-22p::GFP::unc-54 3'UTR + pha-1(+)]. Transcriptional reporter containing pals-22 promoter (coordinates -791 to -1 from start). Maintain at 25C to select for otEx7036. Reference: Leyva-Daz E, et al. Genetics (2017), 207(2):529-545." | WBGene00004010(pha-1) | WBGene00004010(pha-1) | WB-STRAIN:WBStrain00029924 | WormBase (WB) | WB | available | WB-STRAIN:OH15144, CGC_OH15144 | 2026-09-12 11:16:04 | 0 | |||
|
MT10869 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027384 | Caenorhabditis elegans | ced-10(n3417)/lin-1(e1275) dpy-13(e184) IV. | Heterozygotes are semi-Dpy. Throws DpyLins and DTC-defective progeny. | WBGene00000424(ced-10)|WBGene00001074(dpy-13)|WBGene00002990(lin-1) | WBGene00000424(ced-10), WBGene00001074(dpy-13), WBGene00002990(lin-1) | WB-STRAIN:WBStrain00027384 | WormBase (WB) | WB | available | WB-STRAIN:MT10869, CGC_MT10869 | 2026-09-12 11:15:30 | 0 | |||
|
MT11068 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00027386 | Caenorhabditis elegans | ced-12(n3261) I. | Defects in engulfment, persistent cell coprses observed in embyros, larvae, and adult hermaphrodite gonads. Distal tip cell migration defects.|"WBStrain provided so WBPaper00061198 paper added based on AFP_Strain data." | WBGene00000426(ced-12) | WBGene00000426(ced-12) | WB-STRAIN:WBStrain00027386 | WormBase (WB) | WB | available | PMID:33759761 | WB-STRAIN:MT11068, CGC_MT11068 | 2026-09-12 11:15:30 | 5 | ||
|
MT11090 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027387 | Caenorhabditis elegans | mcd-1(n3376) II; nIs106 X. | nIs106 [lin-11::GFP + lin-15(+)] X. Egl, Him. lin-11::GFP expressed in vulva, head neurons, VC neurons. n3376 enhances ced-3(n2427). Reference: (2007) Genetics 175(4)::1719-33. | WBGene00013096(mcd-1) | WBGene00013096(mcd-1) | WB-STRAIN:WBStrain00027387 | WormBase (WB) | WB | available | WB-STRAIN:MT11090, CGC_MT11090 | 2026-09-12 11:15:30 | 0 | |||
|
MT10729 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027380 | Caenorhabditis elegans | EMPTY | EMPTY | WB-STRAIN:WBStrain00027380 | WormBase (WB) | WB | unknown | WB-STRAIN:MT10729 | 2026-09-12 11:15:29 | 0 | |||||
|
MT10784 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027382 | Caenorhabditis elegans | dpy-18(e364) lis-1(n3334) III/eT1 (III;V). | Heterozygotes are WT and segregate WT, Unc-36 (eT1 homozygotes), and dpy-18 lis-1 homozygotes which are Mel, Unc, Egl, and Dpy. | WBGene00001077(dpy-18)|WBGene00003047(lis-1) | WBGene00001077(dpy-18), WBGene00003047(lis-1) | WB-STRAIN:WBStrain00027382 | WormBase (WB) | WB | available | WB-STRAIN:MT10784, CGC_MT10784 | 2026-09-12 11:15:29 | 0 | |||
|
MT10549 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00027377 | Caenorhabditis elegans | tdc-1(n3421) II. | Forages while backing. Deletion in L-aromatic amino acid decarboxylase with homology to histidine decarboxylase. Reference: Alkema M, et al. Neuron. 2005 Apr 21;46(2):247-60.|"Mutagen:UV/TMP" | WBGene00006562(tdc-1) | WBGene00006562(tdc-1) | WB-STRAIN:WBStrain00027377 | WormBase (WB) | WB | available | PMID:37155851 | WB-STRAIN:MT10549, CGC_MT10549 | 2026-09-12 11:15:29 | 1 | ||
|
MT10591 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027378 | Caenorhabditis elegans | lin-8(n2731) II. | Made_by: Ewa Davidson|"SynMuv. Reference: Andersen EC, et al. Genetics. 2008 Aug;179(4):2001-12. Harrison MM, et al. Genetics. 2007 May;176(1):255-71." | WBGene00002997(lin-8) | WBGene00002997(lin-8) | WB-STRAIN:WBStrain00027378 | WormBase (WB) | WB | available | WB-STRAIN:MT10591, CGC_MT10591 | 2026-09-12 11:15:29 | 0 | |||
|
MT10408 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00027374 | Caenorhabditis elegans | lin-53(n833) I; unc-76(e911) V; lin-15A(n767) X; nEx998. | nEx998 [lin-53::GFP + unc-76(+)]. Pick non-Unc, non-Muv to maintain. | WBGene00003004(lin-15)|WBGene00003036(lin-53)|WBGene00006808(unc-76)|WBGene00023498(lin-15A) | WBGene00003004(lin-15), WBGene00003036(lin-53), WBGene00006808(unc-76), WBGene00023498(lin-15A) | WB-STRAIN:WBStrain00027374 | WormBase (WB) | WB | available | WB-STRAIN:MT10408, CGC_MT10408 | 2026-09-12 11:15:29 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.