Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
F344-Albem4(cre)Larc Resource Report Resource Website 1+ mentions |
RRID:RGD_616336067 | Rattus norvegicus | Fertilized eggs from F344/Jcl rats were microinjected and then transplanted into the oviducts of pseudopregnant females. From the resulting offspring, rats with the 2A-Cre sequence inserted into the Albumin gene were selected and established. National BioResource Project for the Rat in Japan | 616336067 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2025-05-14) | 616336067 | 2026-09-19 01:18:57 | 1 | |||||
|
F344-ROSA26em10(Alb-cre)Larc Resource Report Resource Website |
RRID:RGD_616336065 | Rattus norvegicus | F344/Jcl rat fertilized eggs were microinjected and then transplanted into the oviducts of pseudopregnant females. From the resulting offspring, rats with the Alb promoter-Cre sequence inserted into the Rosa26 gene were selected and established. Although the Alb promoter is inserted, cre leakage is confirmed throughout the body. National BioResource Project for the Rat in Japan | 616336065 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2025-05-14) | 616336065 | 2026-09-19 01:18:57 | 0 | |||||
|
LE-Them2-1(cre)Koba Resource Report Resource Website 1+ mentions |
RRID:RGD_598092591 | Rattus norvegicus | The T2A, nlsCre, and BGHpolyA are knocked in at the stop codon in the 13th exon of the tyrosine hydroxylase (TH) gene (NCBI Gene ID: 25085). National BioResource Project for the Rat in Japan | 598092591 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2025-03-27) | 598092591 | 2026-09-19 01:18:56 | 1 | |||||
|
SD-ROSA26 em1(CAG-DdCBE-Mt-co3, NeuN-Cre/Ilas Resource Report Resource Website 1+ mentions |
RRID:RGD_616336063 | Rattus norvegicus | This rat strain with neuronal specific knock out of Mt-co3 was generated by crossing a rat neuron-specific Cre strain (NeuN-Cre) with SD-ROSA26 em1(CAG-loxP-stop-loxP-DdCBE-Mt-co3/Ilas. Compared with the controls, the neuron-specific Mt-co3 knock out rats were largely normal in the first postnatal month, but progressively developed ALS-like symptoms afterward. Rat Resource Center of China (www.ratresource.com) | 616336063 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 616336063 | 2026-09-19 01:18:57 | 1 | |||||
|
LE-Them1(cre)Koba Resource Report Resource Website |
RRID:RGD_598092592 | Rattus norvegicus | The T2A, nlsCre, and BGHpolyA are knocked in at the stop codon in the 13th exon of the tyrosine hydroxylase (TH) gene (NCBI Gene ID: 25085). National BioResource Project for the Rat in Japan | 598092592 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2025-03-27) | 598092592 | 2026-09-19 01:18:56 | 0 | |||||
|
W-Gpr143em19Gosh Resource Report Resource Website |
RRID:RGD_598092593 | Rattus norvegicus | Deletion of exon1 of Gpr143 gene in Wistar rats (Charles River, Japan) by CRISPR/Cas9. Line No. is 19. National BioResource Project for the Rat in Japan | 598092593 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2025-03-28) | 598092593 | 2026-09-19 01:18:56 | 0 | |||||
|
SD-ROSA26 em1(CAG-DdCBE-Mt-co3/Ilas Resource Report Resource Website |
RRID:RGD_616335894 | Rattus norvegicus | The knock in of "CAG-loxP-stop-loxP-DdCBE-Mt-co3" to ROSA26 was induced by CRISPR/Cas9 in SD embryos from Vital River. This ROSA 26 knock in construct carrying DddA-derived cytosine base editor (DdCBE)linked to Mt-co3 was used to introduce premature stop codons in the rat Mt-co3 in mitochondrial genome in the presence of Cre recombinase. Rat Resource Center of China (www.ratresource.com) | 616335894 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 616335894 | 2026-09-19 01:18:57 | 0 | |||||
|
SD-C5ar1em22Taoki Resource Report Resource Website |
RRID:RGD_598092525 | Rattus norvegicus | This strain was established by CRISPR/Cas9 system in the Research Institute, National Cerebral and Cardiovascular Center. Genetic background is Slc:SD. guide RNA gRNA No1; ATAAGTAACGACAGCAGTGA gRNA No2; GAGTTTCACTCGGTCCACGA National BioResource Project for the Rat in Japan | 598092525 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2025-03-25) | 598092525 | 2026-09-19 01:18:56 | 0 | |||||
|
Slc:WSRC-KitWs Resource Report Resource Website |
RRID:RGD_598092524 | Rattus norvegicus | In 1987, a Ws mutant (RGD:12910762) with a light-colored coat and large abdominal white spots was discovered in a colony of BN/fMai inbred rats that had been allocated to Yagi Memorial Park from the Institute of Laboratory Animals Graduate School of Medicine, Kyoto University. However, homozygous for the Ws mutation could not be obtained in BN inbred rats due to embryonic lethality. Therefore, they crossed with Donryu outbred rats and obtained homozygous by crossing F1 heterozygous. This strain was designated as WsRC and was supplied to Japan SLC, Inc. in 1993. National BioResource Project for the Rat in Japan | 598092524 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo (as of 2025-03-25) | 598092524 | 2026-09-19 01:18:56 | 0 | |||||
|
SD-Cyp2dem2(CYP2D6)Kg Resource Report Resource Website |
RRID:RGD_407446371 | Rattus norvegicus | A ~58.0 kb deletion of the rat Cyp2d gene cluster (1-5) was created using the CRISPR-Cas9 system. Subsequently, the human CYP2D6 gene (~6.2 kb) was inserted in place of the rat Cyp2d gene cluster. The rat strain is deposited to Rat Research and Resource Contact [email protected] for availability. | 407446371 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo; Cryopreserved Sperm (as of 2024-08-29) | 407446371 | 2026-09-19 01:18:56 | 0 | |||||
|
SD-Cyp2dem1Kg Resource Report Resource Website |
RRID:RGD_407446370 | Rattus norvegicus | A ~58.0 kb deletion of the rat Cyp2d gene cluster (1-5) was created using the CRISPR-Cas9 system. The rat strain is deposited to Rat Research and Resource Contact [email protected] for availability. | 407446370 | mutant | Rat Genome Database (RGD) | RGD | Unknown (as of 2024-08-29) | 407446370 | 2026-09-19 01:18:56 | 0 | |||||
|
SHR-Tti2em1Ipcv+/- Resource Report Resource Website |
RRID:RGD_405849381 | Rattus norvegicus | This Tti2 knockout rats were generated by microinjecting fertilized ova of SHR/OlaIpcv rats with the ZFN (Zinc Finger Nuclease) construct from Sigma-Aldrich. The construct was designed to target the first exon using the following sequence of ZFN binding (capital letters) and cutting site (small letters): TCTGACCCGGATCCAAGCaccaagGGTGGGTGGCAGGGC. DNA samples isolated from 452 rats born after microinjection with ZFN construct were amplified using primers flanking the target sequence: ZFN F: 5'-TACACTGTGATTGGCTGGGA-3' and ZFN R: 5'-GGCGCAGTGGAGTGATC-3'. SHR-Tti2+/- with an 8 bp deletion (NM_001013883.1(Tti2):c.243_250delCGAGATCC; on the protein level: NP_001013905.1:p.Glu82Glyfs) has been selected for further analyses. The heterozygous founder was crossed with SHR and F1 rats were intercrossed. SHR-Tti2+/- heterozygotes were selected for breeding and phenotyping while their wild type littermates were used as controls. | 405849381 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 405849381 | 2026-09-19 01:18:56 | 0 | |||||
|
SD-Vdrem2Hfd Resource Report Resource Website |
RRID:RGD_408364956 | Rattus norvegicus | The CRISPR/Cas9 system was used to introduce deletion and insertion in exon 3 of the VDR gene of Hsd:SD rat embryos WT: GGAGGCAACAGCGGCCAGCACCTCCCTGCccgaccCTGGTGACTTTGACCggaacgtgccccGGATCTGTGGAGTGTGTGGAGACCGAGCCAC KO: GGAGGCAACAGCGGCCAGCACCTCCCTGCtggt– CTGGTGACTTTGACC------GGATCTGTGGAGTGTGTGGAGACCGAGCCAC Rat Resource and Research Center (RRRC); strain ID 1034 | 408364956 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Embryo (as of 2024-11-05) | 408364956 | 2026-09-19 01:18:56 | 0 | |||||
|
F344-ApcPirc/UwmVdrem3Hfd Resource Report Resource Website |
RRID:RGD_408364957 | Rattus norvegicus | The F344-ApcPirc rat was generated previously by ENU mutagenesis (RGD ID 1641862). These fertilized rat embryos were used with the CRISPR/Cas9 system to introduce a 5-bp deletion (CCCCG) in exon 3 of the Vdr gene. This mutant was heterozygous for the Apc mutation and homozygous for the VDR deletion. WT: GGAGGCAACAGCGGCCAGCACCTCCCTGCCCGACCCTGGTGACTTTGACCGGAACGTGCCCCGGATCTGTGGAGTGTGTGGAGACCGAGCCAC KO: GGAGGCAACAGCGGCCAGCACCTCCCTGCCCGACCCTGGTGACTTTGACCGGAACGTGG ATCTGTGGAGTGTGTGGAGACCGAGCCAC Rat Resource and Research Center (RRRC); strain ID 1033 | 408364957 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2024-11-05) | 408364957 | 2026-09-19 01:18:56 | 0 | |||||
|
SD-Eml1tish/Scrb Resource Report Resource Website |
RRID:RGD_597538479 | Rattus norvegicus | The first tish animals were identified on the basis of postmortem histological analyses during the course of unrelated experiments using a strain of Sprague Dawley rats maintained at the University of Virginia. It is called tish (telencephalic internal structural heterotopia) rat. The brain of this mutant animal exhibits a large region of heterotopic gray matter that is located bilaterally beneath the neocortex. Mild to moderate ventriculomegaly is also observed in most tish animals. A breeding colony was established by identifying living relatives of deceased tish individuals, and then these relatives were screened using magnetic resonance imaging (MRI). The tish is identified recessive to wild type by breeding. The mutation was identified as a 1215 bp deletion in the unannotated exon 1 of Eml1 genome (Rnor_6.0; ENSRNOG00000043143). University of Virginia, Charlottesville, VA, United States | 597538479 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 597538479 | 2026-09-19 01:18:56 | 0 | |||||
|
SD-Il6em1Yona-/- Resource Report Resource Website |
RRID:RGD_407450413 | Rattus norvegicus | The Il6 knockout (KO) rats were generated using the CRISPR/Cas9 technique to induce a shift in the reading frame of the second exon of Il6 by KAC Co. Ltd (Kyoto, Japan). This strain carried a 118 bp deleted in the second exon of IL-6 National Cerebral and Cardiovascular Center Research Institute, Suita, Osaka 564-8565, Japan | 407450413 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 407450413 | 2026-09-19 01:18:56 | 0 | |||||
|
WIC;W-Oprk1em1(cre)Nurep Resource Report Resource Website |
RRID:RGD_598154602 | Rattus norvegicus | Oprk1-cre rats were generated by Dr. Hiroko Tsukamura, Dr. Yoshihisa Uenoyama, Dr. Naoko Inoue, Dr. Mayuko Nagae (Nagoya University) and Dr. Masumi Hirabayashi (National Institute for Physiological Sciences). The CRISPR/Cas9 and adeno-associated virus vector (Oprk1 [exon 4], T2A, Cre) were introduced into the pronuclear stage embryos of Wistar rats (Crlj:WI). It was maintained by mating with the Wistar-Imamichi rats (Iar:WIC) (RGD:125097496) or by sibling mating. National BioResource Project for the Rat in Japan | 598154602 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2025-04-30) | 598154602 | 2026-09-19 01:18:57 | 0 | |||||
|
ZFDM-Lcn2em1Nyo Resource Report Resource Website |
RRID:RGD_598154604 | Rattus norvegicus | "This knock-in rat was generated by injecting guide RNA, Cas9 protein, and ssODN targeting the Lcn2 gene into fertilized eggs of ZFDM rats. The Lcn2 gene of ZFDM rats has a nonsense mutation (c.409C>T, p.Gln137X), but in this line, this mutation is replaced with the wild type sequence by homologous recombination with the introduced ssODN. The target sequence of the guide RNA is TGACTACGACTAGTTTGCCA. The ssODN sequence for inducing homologous recombination is AAGTGGCCGACACTGACTACGACCAGTTTGCCATGGTATTTTTCCAGAAGACCTCTGAAA. " National BioResource Project for the Rat in Japan | 598154604 | mutant | Rat Genome Database (RGD) | RGD | Cryopreserved Sperm (as of 2025-04-30) | 598154604 | 2026-09-19 01:18:57 | 0 | |||||
|
SD-Crhtm1(Cre)Kji Resource Report Resource Website 1+ mentions |
RRID:RGD_401976372 | Rattus norvegicus | CRISPR/Cas9 technology was used to insert an IRES for Cre expression after the corticotropin-releasing hormone (Crh) gene and is expressed in cells that produce CRH. | 401976372 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 401976372 | 2026-09-19 01:18:56 | 1 | |||||
|
SD-Prnpem1Evm Resource Report Resource Website |
RRID:RGD_630350554 | Rattus norvegicus | A deletion mutation was induced using CRISPR/Cas9 system in embryos of Spague-Dawley rats from Charles River. This strain has been deposited with the RRRC | 630350554 | mutant | Rat Genome Database (RGD) | RGD | Live Animals (as of 2026-01-15) | 630350554 | 2026-09-19 01:18:57 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
