Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00022583
Source Database: WormBase (WB)
Affected Genes: WBGene00001077(dpy-18)
Genomic Alteration: WBGene00001077(dpy-18)
Availability: available
Source References: PMID:10781079, PMID:38177158
Synonyms: dpy-18(ok162) III.
Alternate IDs: WB-STRAIN:JK2729, CGC_JK2729
Notes: Medium Dpy. Robert Barstead deletion mutant in T28D6. Prolyl-4-hydroxylase alpha subunit. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
Proper citation: RRID:WB-STRAIN:WBStrain00022583 Copy
http://www.wormbase.org/db/get?name=WBStrain00022585
Source Database: WormBase (WB)
Affected Genes: WBGene00000445(ceh-22)
Genomic Alteration: WBGene00000445(ceh-22)
Availability: available
Synonyms: ceh-22(q632) V.
Alternate IDs: WB-STRAIN:JK2736, CGC_JK2736
Notes: Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
Proper citation: RRID:WB-STRAIN:WBStrain00022585 Copy
http://www.wormbase.org/db/get?name=WBStrain00022588
Source Database: WormBase (WB)
Affected Genes: WBGene00004025(phy-2)
Genomic Alteration: WBGene00004025(phy-2)
Availability: available
Source References: PMID:10781079
Synonyms: phy-2(ok177) IV.
Alternate IDs: WB-STRAIN:JK2757, CGC_JK2757
Notes: WT. Deletion mutant in F35G2.4. Prolyl 4 hydroxylase #2 deletion. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
Proper citation: RRID:WB-STRAIN:WBStrain00022588 Copy
http://www.wormbase.org/db/get?name=WBStrain00022587
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00006379(sys-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00006379(sys-1)
Availability: available
Synonyms: sys-1(q544) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:JK2751, CGC_JK2751
Notes: Heterozygotes are WT. q544 is homozygous embryonic lethal. hT2[qIs48] homozygotes are inviable. PIck GFP+ wild-type to maintain. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Made_by: K. Siegfried"
Proper citation: RRID:WB-STRAIN:WBStrain00022587 Copy
http://www.wormbase.org/db/get?name=WBStrain00022580
Source Database: WormBase (WB)
Affected Genes: WBGene00003785(nos-3)
Genomic Alteration: WBGene00003785(nos-3)
Availability: available
Source References: PMID:10508609
Synonyms: nos-3(q650) II.
Alternate IDs: WB-STRAIN:JK2589, CGC_JK2589
Notes: Grows well as a homozgyote. 0.3% sterile at 20C (0.2% have masculinized germ lines). Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00022580 Copy
http://www.wormbase.org/db/get?name=WBStrain00022571
Source Database: WormBase (WB)
Affected Genes: WBGene00001413(fem-3)
Genomic Alteration: WBGene00001413(fem-3)
Availability: available
Source References: PMID:25060624
Synonyms: fem-3(q96) IV.
Alternate IDs: WB-STRAIN:JK1973, CGC_JK1973
Notes: Made_by: M. Gallegos|"Semi-dominant Mog. Temperature-sensitive sterile. Maintain at 15C. Masculization of germline (Mog) at 25C."
Proper citation: RRID:WB-STRAIN:WBStrain00022571 Copy
http://www.wormbase.org/db/get?name=WBStrain00022570
Source Database: WormBase (WB)
Affected Genes: WBGene00001168(eef-1A.1)|WBGene00004857(sma-3)|WBGene00006772(unc-36)
Genomic Alteration: WBGene00001168(eef-1A.1), WBGene00004857(sma-3), WBGene00006772(unc-36)
Availability: available
Source References: PMID:9017394
Synonyms: eef-1A.1(q145)/sma-3(e491) unc-36(e251) III.
Alternate IDs: WB-STRAIN:JK1774, CGC_JK1774
Notes: Heterozygotes are WT and segregate WT, SmaUnc and Steriles. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be used for any commercial purpose or for work on human subjects. eft-3(q145) previously called glp-3(q145).
Proper citation: RRID:WB-STRAIN:WBStrain00022570 Copy
http://www.wormbase.org/db/get?name=WBStrain00022573
Source Database: WormBase (WB)
Affected Genes: WBGene00002246(lag-2)
Genomic Alteration: WBGene00002246(lag-2)
Availability: available
Synonyms: qIs19 V.
Alternate IDs: WB-STRAIN:JK2049, CGC_JK2049
Notes: Made_by: D. Gao|"qIs19 [lag-2p::GFP::unc-54 3'UTR + rol-6(su1006)] V. Rollers. Integration of qEx233. GFP expression in DTCs and other defined regions. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."
Proper citation: RRID:WB-STRAIN:WBStrain00022573 Copy
http://www.wormbase.org/db/get?name=WBStrain00022572
Source Database: WormBase (WB)
Affected Genes: WBGene00001653(gon-4)
Genomic Alteration: WBGene00001653(gon-4)
Availability: available
Synonyms: gon-4(q519) IV/nT1 [unc-?(n754) let-?] (IV;V).
Alternate IDs: WB-STRAIN:JK2009, CGC_JK2009
Notes: Heterozygotes are Unc and segregate Uncs, dead eggs and Steriles with a small white patch. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Made_by: Sonia Santa Anna"
Proper citation: RRID:WB-STRAIN:WBStrain00022572 Copy
http://www.wormbase.org/db/get?name=WBStrain00022577
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00003393(mog-5)|WBGene00006744(unc-4)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00003393(mog-5), WBGene00006744(unc-4)
Availability: available
Source References: PMID:10737793
Synonyms: mog-5(q449) unc-4(e120)/mIn1 [dpy-10(e128)] II.
Alternate IDs: WB-STRAIN:JK2321, CGC_JK2321
Notes: Heterozygotes are WT and segregate WT, Dpys, and Uncs which make excess sperm, are elongated and tend to coil, are slow and have poor backing. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
Proper citation: RRID:WB-STRAIN:WBStrain00022577 Copy
http://www.wormbase.org/db/get?name=WBStrain00022644
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00001595(gld-1)|WBGene00001596(gld-2)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001595(gld-1), WBGene00001596(gld-2)
Availability: available
Synonyms: gld-2(q497) gld-1(q361) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:JK4299, CGC_JK4299
Notes: Pick GFP+ heterozygotes to maintain. Segregates fertile GFP+ heterozygotes, non-GFP homozygous mutants (Gld; form germline tumors), very rare GFP+ homozygous hT2, and dead eggs. gld-1(q361) is a missense allele but phenotypically null, which allows the detection of gld-1 mRNA and protein by single molecule FISH or antibody staining. Reference: Hansen et al (2004) Dev. Biol. 2004;268(2):342-57. Shin et al. (2017) PLoS Genet. 2017;13(12):e1007121.
Proper citation: RRID:WB-STRAIN:WBStrain00022644 Copy
http://www.wormbase.org/db/get?name=WBStrain00022646
Source Database: WormBase (WB)
Availability: available
Synonyms: qIs154 V.
Alternate IDs: WB-STRAIN:JK4472, CGC_JK4472
Notes: qIs154 [lag-2p::MYR::tdTomato + ttx-3p::GFP] V. Myristylated tdTomato localizes to plasma membrane of DTC and other lag-2-expressing cells. Reference: Byrd DT, et al. PLoS One. 2014 Feb 19;9(2):e88372.
Proper citation: RRID:WB-STRAIN:WBStrain00022646 Copy
http://www.wormbase.org/db/get?name=WBStrain00022648
Source Database: WormBase (WB)
Affected Genes: WBGene00020097(larp-1)
Genomic Alteration: WBGene00020097(larp-1)
Availability: available
Source References: PMID:33157031, PMID:33593818
Synonyms: larp-1(q783) III.
Alternate IDs: WB-STRAIN:JK4545, CGC_JK4545
Notes: Derived by outcrossing JK3826 to remove mut-16 deletion. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Made_by: N Nykamp"|"WBStrain mapped, WBPaper00060602 added based on AFP_Strain data."|"WBStrain provided so WBPaper00061063 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00022648 Copy
http://www.wormbase.org/db/get?name=WBStrain00022640
Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00001401(fbf-1)|WBGene00001402(fbf-2)|WBGene00001413(fem-3)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00001401(fbf-1), WBGene00001402(fbf-2), WBGene00001413(fem-3)
Availability: available
Synonyms: fbf-1(ok91) fbf-2(q704)/mIn1 [mIs14 dpy-10(e128)] II; fem-3(e1996)/qIs24 IV.
Alternate IDs: WB-STRAIN:JK3965, CGC_JK3965
Notes: qIs24 [lag-2p::GFP]. Maintain by picking individual animals with green DTCs and green pharynx and scoring offspring for Fems and Fbfs. fem-3 is not well balanced by qIs24. fbf-1 fbf-2 homozygotes are germline proliferation defective and make only sperm. fem-3 homozygotes make only oocytes. fbf-1 fbf-3; fem-3 proliferates more than fbf-1 fbf-2 and makes only oocytes; also Muv. qIs24 contains lag-2::GFP; Distal Tip Cells are green; homozygotes are Rollers and heterozygotes Roll weakly. mIn1 is Dpy and GFP+ in the pharynx. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
Proper citation: RRID:WB-STRAIN:WBStrain00022640 Copy
http://www.wormbase.org/db/get?name=WBStrain00022642
Source Database: WormBase (WB)
Affected Genes: WBGene00001949(hlh-2)
Genomic Alteration: WBGene00001949(hlh-2)
Availability: available
Synonyms: hlh-2(tm1768) I.
Alternate IDs: WB-STRAIN:JK4099, CGC_JK4099
Notes: Temperature sensitive sterile. Partially sterile at 20 C; completely sterile at 25 C. Maintain at <20 C. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
Proper citation: RRID:WB-STRAIN:WBStrain00022642 Copy
http://www.wormbase.org/db/get?name=WBStrain00022633
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00001481(fog-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001481(fog-1)
Availability: available
Synonyms: fog-1(q785) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:JK3743, CGC_JK3743
Notes: Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"WBStrain mapped, WBPaper00061440 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00022633 Copy
http://www.wormbase.org/db/get?name=WBStrain00022636
Source Database: WormBase (WB)
Affected Genes: WBGene00006379(sys-1)
Genomic Alteration: WBGene00006379(sys-1)
Availability: available
Synonyms: sys-1(q544) I; qIs95 III.
Alternate IDs: WB-STRAIN:JK3791, CGC_JK3791
Notes: Made_by: B. Phillips|"qIs95 [(sys-1p::Venus::sys-1 + pttx-3::dsRed]. The dsRed marker is very dim and might be difficult to see it under the dissecting scope. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."|"qIs95 [(sys-1p::Venus::sys-1 + pttx-3::DsRed]. The DsRed marker is very dim and might be difficult to see it under the dissecting scope. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects."
Proper citation: RRID:WB-STRAIN:WBStrain00022636 Copy
http://www.wormbase.org/db/get?name=WBStrain00022638
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00001595(gld-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00001595(gld-1)
Availability: available
Synonyms: gld-1(q93) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I; III).
Alternate IDs: WB-STRAIN:JK3934, CGC_JK3934
Notes: Heterozygotes are WT, GFP+ in the pharynx and segregate WT (GFP+ in the pharynx), dead eggs (hT2 homozygotes) and non-GFP gld-1(q93) homozygotes with masculinized germlines. Some heterozygotes will also have a masculinized germline. Maintain by picking GFP worms and checking for correct segregation, since the hT2 balancer is lost at low frequencies. gld-1(q93) was isolated as a dominant suppressor of fem-1(hc17).
Proper citation: RRID:WB-STRAIN:WBStrain00022638 Copy
http://www.wormbase.org/db/get?name=WBStrain00022637
Source Database: WormBase (WB)
Affected Genes: WBGene00003508(mut-16)|WBGene00020097(larp-1)
Genomic Alteration: WBGene00003508(mut-16), WBGene00020097(larp-1)
Availability: available
Synonyms: mut-16(mg461) I; larp-1(q783) III.
Alternate IDs: WB-STRAIN:JK3826, CGC_JK3826
Notes: Slow growing and throw about 10% dead embryos. q783 is a deletion of the first 4 exons on the larp-1 gene. NOTE: this strain is carrying mut-16(mg461) in the background; It is unknown if mg461 is homozygous in this strain. See JK4545 for a replacement larp-1(q783) strain. mut-16 can be detected using primer1 CCCGCCGATACAGAAACTAA, primer 2 AATATTCGATCGGCAAGCAG for genotyping. The wild-type locus will yield a 824bp PCR product, whereas mg461 will yield a 373bp product. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
Proper citation: RRID:WB-STRAIN:WBStrain00022637 Copy
http://www.wormbase.org/db/get?name=WBStrain00022630
Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00004077(pop-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00004077(pop-1)
Availability: available
Synonyms: pop-1(q772) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:JK3501, CGC_JK3501
Notes: Heterozygotes are WT and GFP+. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. q772 is embryonic lethal.
Proper citation: RRID:WB-STRAIN:WBStrain00022630 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
