Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search
Reset search
On page 174 showing 3461 ~ 3480 out of 64,152 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

http://www.wormbase.org/db/get?name=WBStrain00052755

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:31519743
Synonyms: lin-12(n302)/qC1; sel-10 (ar41) him-5 (e1490)
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00052755 Copy   

http://www.wormbase.org/db/get?name=WBStrain00052756

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:31519743
Synonyms: cdk-11.1(gk1202)/mIn1[mIs14]; lin-12(n302)
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00052756 Copy   

http://www.wormbase.org/db/get?name=WBStrain00052757

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:31519743
Synonyms: lin-12(n302); kin-20(ok505)
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00052757 Copy   

http://www.wormbase.org/db/get?name=WBStrain00052751

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:31519743
Synonyms: lin-12(n302); nre-1(hd20) lin-15B(hd126)
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00052751 Copy   

http://www.wormbase.org/db/get?name=WBStrain00052754

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:31519743
Synonyms: sel-10 (ar41) him-5 (e1490)
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00052754 Copy   

http://www.wormbase.org/db/get?name=WBStrain00052759

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:31519743
Synonyms: cdk-8(tm1238); lin-12(n302)
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00052759 Copy   

http://www.wormbase.org/db/get?name=WBStrain00052865

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:36645076
Synonyms: nfu-1(av246)[FRT::nfu-1::FRT]) IV; bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi495 [myo-3p::FLP D5 unc-119(+)] IV
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00052865 Copy   

http://www.wormbase.org/db/get?name=WBStrain00052868

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:36645076
Synonyms: nfu-1(av167) [])/tmC5 IV; avIs286 [eft-3p::nfu-1::unc-54 3UTR] V
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00052868 Copy   

http://www.wormbase.org/db/get?name=WBStrain00052863

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:34875684
Synonyms: mec-8(csb22); Ex[mec-3p::elp-1 exon 5 splicing reporter]
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00052863 Copy   

http://www.wormbase.org/db/get?name=WBStrain00052864

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:36712331
Synonyms: otIs377 [myo-3p::mCherry]; unc-64(e246) III
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00052864 Copy   

http://www.wormbase.org/db/get?name=WBStrain00052869

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:36645076
Synonyms: nfu-1(av167)[])/tmC5 IV; avIs287 [eft-3p::hNFU1::unc-54 3UTR] V
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00052869 Copy   

http://www.wormbase.org/db/get?name=WBStrain00052904

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37067863
Synonyms: mIs10; hlh-8(th16) 95103
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00052904 Copy   

http://www.wormbase.org/db/get?name=WBStrain00052856

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:34875684
Synonyms: mec-8(e398); Is[mec-4p::GFP]
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00052856 Copy   

    • RRID:WB-STRAIN:WBStrain00052857

http://www.wormbase.org/db/get?name=WBStrain00052857

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:34875684
Synonyms: Ex[MEC-8::GFP fosmid]
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00052857 Copy   

http://www.wormbase.org/db/get?name=WBStrain00052850

Source Database: WormBase (WB)
Affected Genes: WBGene00001187(egl-19)
Genomic Alteration: WBGene00001187(egl-19)
Availability: available
Source References: PMID:37746064
Synonyms: egl-19(utx45[egl-19(A&B)::mScarlet-I-C1::3xMyc] IV.
Alternate IDs: CGC_GLW53
Notes: Internal tag of EGL-19 at N-terminal side of exon 3 via CRISPR/Cas9 knock-in of mScarlet at egl-19 locus. Tags isoforms a and b. Insertion verified by PCR and fluorescence. Left flank: 5' ttatttgaatgagcaaaaaataaatttcag 3'; Right flank: 5' GCCGCAGTGGCAGCTTCATCATCACAAGAT 3 (1 silent mutation); gRNA: TTGTGATGATGAAGCTGCCA; Cas9/sgRNA plasmid: pGLOW69; mScarlet^SEC^3xMyc plasmid: pGLOW60; SEC insertion allele strain (balanced): GLW52.|"Made_by: Kara McDonald (Glow Worms '21)"|"[2023-06-29T19:05:01.936Z WBPerson712] New Strain: WBPaper00065588 GLW53 egl-19(utx45[egl-19(ab1-33)::mScarlet::3xMyc::egl-19(ab34-)] IV Referred to herein as mScarlet::EGL-19(ab). Internal mScarlet tag at the 5 end of exon 3 that tags isoforms a and b. The insertion was verified by PCR and fluorescence. Left flank: 5 ttatttgaatgagcaaaaaataaatttcag 3; Right flank: 5' GCCGCAGTGGCAGCTTCATCATCACAAGAT 3 (1 silent mutation); gRNA: TTGTGATGATGAAGCTGCCA; Cas9/sgRNA plasmid: pGLOW69; mScarlet^SEC^3xMyc plasmid: pGLOW60. Strain available from the CGC."

Proper citation: RRID:WB-STRAIN:WBStrain00052850 Copy   

    • RRID:WB-STRAIN:WBStrain00052858

http://www.wormbase.org/db/get?name=WBStrain00052858

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:34875684
Synonyms: Ex[MEC-2B::GFP
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00052858 Copy   

    • RRID:WB-STRAIN:WBStrain00052845

http://www.wormbase.org/db/get?name=WBStrain00052845

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37602280
Synonyms: EMPTY
Notes: [2023-06-27T17:55:48.116Z WBPerson712] New Strain: CK1341 sut-2(bk3011); bkIs10 [aex-3p::tau(V337M 4R1N); myo-2p::dsRED] III WBPaper00065587

Proper citation: RRID:WB-STRAIN:WBStrain00052845 Copy   

    • RRID:WB-STRAIN:WBStrain00052846

http://www.wormbase.org/db/get?name=WBStrain00052846

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:37602280
Synonyms: EMPTY
Notes: [2023-06-27T17:56:30.55Z WBPerson712] New Strain: CK1342 sut-2(bk3012); bkIs10 [aex-3p::tau(V337M 4R1N); myo-2p::dsRED] III WBPaper00065587

Proper citation: RRID:WB-STRAIN:WBStrain00052846 Copy   

http://www.wormbase.org/db/get?name=WBStrain00052840

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:36645076
Synonyms: avIs287 [eft-3p::hNFU1::unc-54 3UTR] V
Notes: [2023-06-19T15:17:05.379Z WBPerson2987] New Strain: WBPaper00064917, Table S8, genotype: avIs287 [eft-3p::hNFU1::unc-54 3UTR] V

Proper citation: RRID:WB-STRAIN:WBStrain00052840 Copy   

http://www.wormbase.org/db/get?name=WBStrain00052842

Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:36645076
Synonyms: avIs285 [rab-3p::nfu-1::rab-3 3 UTR] V
Notes: [2023-06-19T15:18:39.431Z WBPerson2987] New Strain: WBPaper00064917, Table S8, genotype: avIs285 [rab-3p::nfu-1::rab-3 3 UTR] V

Proper citation: RRID:WB-STRAIN:WBStrain00052842 Copy   

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X

  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web.  We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.

Recent News Entries

Recommendations for repositories and scientific gateways from a neuroscience perspective

NEURON course at the CNS meeting

Neuron Course this year has just been announced!

Contact Us

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch