Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00022449
Source Database: WormBase (WB)
Affected Genes: WBGene00001402(fbf-2)
Genomic Alteration: WBGene00001402(fbf-2)
Availability: available
Synonyms: fbf-2(ax2057[fbf-2::GFP]) II.
Alternate IDs: WB-STRAIN:JH3201, CGC_JH3201
Notes: Maintain at 20-25C. ax2057 was produced by mutation of the sgRNA site and insertion of GFP cDNA at the C-terminus of fbf-2. Insertion of GFP cDNA (from pCM1.53, no ATG/no STOP) at the C-terminus of fbf-2: ATCATCGCCGTGACTACCA(GFP) between II:6089145...6089165. sgRNA site was mutated to avoid Cas9 re-cutting. Reference: Paix A, et al. Genetics. 2014 Sep 23.
Proper citation: RRID:WB-STRAIN:WBStrain00022449 Copy
http://www.wormbase.org/db/get?name=WBStrain00022448
Source Database: WormBase (WB)
Affected Genes: WBGene00010677(gtbp-1)
Genomic Alteration: WBGene00010677(gtbp-1)
Availability: available
Synonyms: gtbp-1(ax2055[gtbp-1::GFP]) IV.
Alternate IDs: WB-STRAIN:JH3199, CGC_JH3199
Notes: Maintain at 20-25C. Insertion of GFP cDNA (from pCM1.53, no ATG/no STOP) at the C-terminus of gtbp-1: ATTTTGTCCCGCATTTTGGAAACCGCTACGCATTCCTCCACGC(GFP) between IV: 10127239-10127283. sgRNA site was mutated to avoid Cas9 re-cutting. Reference: Paix A, et al. Genetics. 2014 Sep 23.
Proper citation: RRID:WB-STRAIN:WBStrain00022448 Copy
http://www.wormbase.org/db/get?name=WBStrain00022443
Source Database: WormBase (WB)
Affected Genes: WBGene00003230(mex-5)
Genomic Alteration: WBGene00003230(mex-5)
Availability: available
Synonyms: mex-5(ax2041[3xFLAG::mex-5]) IV.
Alternate IDs: WB-STRAIN:JH3188, CGC_JH3188
Notes: Maintain at 20C. 3xFLAG-tagged MEX-5. Reference: Paix A, et al. Genetics. 2014 Sep 23.
Proper citation: RRID:WB-STRAIN:WBStrain00022443 Copy
http://www.wormbase.org/db/get?name=WBStrain00022445
Source Database: WormBase (WB)
Affected Genes: WBGene00003784(nos-2)
Genomic Alteration: WBGene00003784(nos-2)
Availability: available
Synonyms: nos-2(ax2049[3XFLAG::nos-2]) II.
Alternate IDs: WB-STRAIN:JH3193, CGC_JH3193
Notes: Made_by: Chih-Yung Lee|"Maintain at 20C. FLAG::NOS-2 can be detected from P4 to Z2/Z3 stage. Reference: Paix A, et al. Genetics. 2014 Sep 23."
Proper citation: RRID:WB-STRAIN:WBStrain00022445 Copy
http://www.wormbase.org/db/get?name=WBStrain00022444
Source Database: WormBase (WB)
Affected Genes: WBGene00003230(mex-5)
Genomic Alteration: WBGene00003230(mex-5)
Availability: available
Synonyms: mex-5(ax2043[OLLAS::mex-5]) IV.
Alternate IDs: WB-STRAIN:JH3190, CGC_JH3190
Notes: Maintain at 20C. OLLAS-tagged MEX-5. Reference: Paix A, et al. Genetics. 2014 Sep 23.
Proper citation: RRID:WB-STRAIN:WBStrain00022444 Copy
http://www.wormbase.org/db/get?name=WBStrain00022437
Source Database: WormBase (WB)
Affected Genes: WBGene00009976(swan-2)|WBGene00009977(swan-1)
Genomic Alteration: WBGene00009976(swan-2), WBGene00009977(swan-1)
Availability: available
Synonyms: swan-1&swan-2(ax2072) V.
Alternate IDs: WB-STRAIN:JH3159, CGC_JH3159
Notes: Deletion of the operon CEOP 5400, removing both swan-1 and swan-2 (V: 13801629-13807223). No reported phenotype. Reference: Paix A, et al. Genetics. 2014 Sep 23.
Proper citation: RRID:WB-STRAIN:WBStrain00022437 Copy
http://www.wormbase.org/db/get?name=WBStrain00022433
Source Database: WormBase (WB)
Affected Genes: WBGene00001569(meg-3)
Genomic Alteration: WBGene00001569(meg-3)
Availability: available
Synonyms: meg-3(tm4259) X; axIs2076.
Alternate IDs: WB-STRAIN:JH3153, CGC_JH3153
Notes: axIs2076 [meg-3p::GFP::meg-3::meg-3 3'UTR + unc-119(+)]. Maintain at 25C and pick non-Unc to retain transgene expression. Reference: Wang JT, et al. eLife 2014;3:e04591.
Proper citation: RRID:WB-STRAIN:WBStrain00022433 Copy
http://www.wormbase.org/db/get?name=WBStrain00022470
Source Database: WormBase (WB)
Affected Genes: WBGene00001074(dpy-13)|WBGene00004804(skn-1)
Genomic Alteration: WBGene00001074(dpy-13), WBGene00004804(skn-1)
Availability: available
Synonyms: dpy-13(e184) skn-1(zu67) IV; mDp1 (IV;f).
Alternate IDs: WB-STRAIN:JJ185, CGC_JJ185
Notes: Animals with the duplication are WT. Animals which have lost the duplication are Dpy and give only dead eggs.
Proper citation: RRID:WB-STRAIN:WBStrain00022470 Copy
http://www.wormbase.org/db/get?name=WBStrain00022469
Source Database: WormBase (WB)
Availability: available
Synonyms: jinEx10.
Alternate IDs: WB-STRAIN:JIN1679, CGC_JIN1679
Notes: jinEx10 [hlh-30p::hlh-30::GFP + rol-6(su1006)]. Pick Rollers to maintain. hlh-30::GFP expression should be visible at relatively low magnification. Reference: Lapierre LR, et. al. Nat Commun. 2013 Aug 8;4:2267.
Proper citation: RRID:WB-STRAIN:WBStrain00022469 Copy
http://www.wormbase.org/db/get?name=WBStrain00022468
Source Database: WormBase (WB)
Affected Genes: WBGene00020930(hlh-30)
Genomic Alteration: WBGene00020930(hlh-30)
Availability: available
Source References: PMID:32302543, PMID:37957360, PMID:38446031, PMID:38529797, PMID:39418305, PMID:39995862
Synonyms: hlh-30(tm1978) IV.
Alternate IDs: WB-STRAIN:JIN1375, CGC_JIN1375
Notes: Made_by: Mitani & Irazoqui|"Superficially wild-type. Grows at standard conditions. Reference: Settembre C, et al. Nat Cell Biol. 2013 Jun;15(6):647-58."|"Supplementary_genotype hlh-30(tm1978) IV"|"WBStrain mapped, WBPaper00059578 added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00022468 Copy
http://www.wormbase.org/db/get?name=WBStrain00022501
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Synonyms: unc-119(ed3) III; zuEx181.
Alternate IDs: WB-STRAIN:JJ1851, CGC_JJ1851
Notes: zuEx181[his-72(1kb 5' UTR)::YFP::GSRPVAT::HIS-72::HIS-72 (1KB 3'UTR) + 5.7 kb XbaI - HindIII UNC-119(+)]. HIS-72::YFP signal can be detected in the germline and most somatic nuclei, but not in intestinal nuclei.
Proper citation: RRID:WB-STRAIN:WBStrain00022501 Copy
http://www.wormbase.org/db/get?name=WBStrain00022463
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Synonyms: unc-119(tm4063) III; ujEx173.
Alternate IDs: WB-STRAIN:JIM173, CGC_JIM173
Notes: Made_by: E Preston & T Walton|"ujEx173 [ceh-36::TY1::EGFP::3xFLAG + unc-119(+)]. Pick non-Unc to maintain. Reference: Walton T, et al. PLoS Genet. 2015 Mar 4;11(3):e1005003."
Proper citation: RRID:WB-STRAIN:WBStrain00022463 Copy
http://www.wormbase.org/db/get?name=WBStrain00022452
Source Database: WormBase (WB)
Affected Genes: WBGene00022034(deps-1)
Genomic Alteration: WBGene00022034(deps-1)
Availability: available
Synonyms: deps-1(ax2063[deps-1::GFP]) I.
Alternate IDs: WB-STRAIN:JH3207, CGC_JH3207
Notes: Alt Genotype: deps-1(ax2063[deps-1::GFP]) I.|"Contains Construct ref: Paix A, et al. Genetics. 2014"|"Made_by: J Smith & T Lu"|"Maintain at 20C. GFP inserted at N-terminus of deps-1. Reference: Paix A, et al. Genetics. 2014 Sep 23."|"N-terminus GFP tag on deps-1"
Proper citation: RRID:WB-STRAIN:WBStrain00022452 Copy
http://www.wormbase.org/db/get?name=WBStrain00022451
Source Database: WormBase (WB)
Affected Genes: WBGene00003004(lin-15)|WBGene00023497(lin-15B)
Genomic Alteration: WBGene00003004(lin-15), WBGene00023497(lin-15B)
Availability: available
Synonyms: lin-15B(ax2061[lin-15B::GFP]) X.
Alternate IDs: WB-STRAIN:JH3205, CGC_JH3205
Notes: Maintain at 20C. Nuclear expression of lin-15B::GFP in oocytes and embryos. Reference: Paix A, et al. Genetics. 2014 Sep 23.
Proper citation: RRID:WB-STRAIN:WBStrain00022451 Copy
http://www.wormbase.org/db/get?name=WBStrain00022453
Source Database: WormBase (WB)
Affected Genes: WBGene00003231(mex-6)
Genomic Alteration: WBGene00003231(mex-6)
Availability: available
Synonyms: mex-6(ax2065[mex-6::GFP]) II.
Alternate IDs: WB-STRAIN:JH3209, CGC_JH3209
Notes: GFP-tagged mex-6. Reference: Paix A, et al. Genetics. 2014 Sep 23.|"Made_by: Paix/J Smith/Y Wang"
Proper citation: RRID:WB-STRAIN:WBStrain00022453 Copy
http://www.wormbase.org/db/get?name=WBStrain00022456
Source Database: WormBase (WB)
Affected Genes: WBGene00001569(meg-3)|WBGene00016485(meg-4)
Genomic Alteration: WBGene00001569(meg-3), WBGene00016485(meg-4)
Availability: available
Synonyms: meg-3(tm4259) meg-4(ax2026) X.
Alternate IDs: WB-STRAIN:JH3225, CGC_JH3225
Notes: P granule defect. High sterility. Reference: Wang JT, et al. eLife 2014;3:e04591.
Proper citation: RRID:WB-STRAIN:WBStrain00022456 Copy
http://www.wormbase.org/db/get?name=WBStrain00022455
Source Database: WormBase (WB)
Affected Genes: WBGene00010677(gtbp-1)
Genomic Alteration: WBGene00010677(gtbp-1)
Availability: available
Synonyms: gtbp-1(ax2073) IV.
Alternate IDs: WB-STRAIN:JH3215, CGC_JH3215
Notes: 1.6kb deletion in gtbp-1 between IV: 10127264...10128913 and insertion of NheI restriction site (GCTAGC). Homozygous viable. Reference: Paix A, et al. Genetics. 2014 Sep 23.
Proper citation: RRID:WB-STRAIN:WBStrain00022455 Copy
http://www.wormbase.org/db/get?name=WBStrain00022524
Source Database: WormBase (WB)
Affected Genes: WBGene00001076(dpy-17)|WBGene00004943(sog-10)
Genomic Alteration: WBGene00001076(dpy-17), WBGene00004943(sog-10)
Availability: available
Source References: PMID:8307319
Synonyms: sog-10(q162) dpy-17(e164) III.
Alternate IDs: WB-STRAIN:JK845, CGC_JK845
Notes: Dpy. Cold-sensitive Fog phenotype; incompletely penetrant, even at 12C. Low percentage of sterile hermaphrodites with an Ooc phenotype. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
Proper citation: RRID:WB-STRAIN:WBStrain00022524 Copy
http://www.wormbase.org/db/get?name=WBStrain00022527
Source Database: WormBase (WB)
Affected Genes: WBGene00001609(glp-1)|WBGene00006768(unc-32)|WBGene00006772(unc-36)
Genomic Alteration: WBGene00001609(glp-1), WBGene00006768(unc-32), WBGene00006772(unc-36)
Availability: available
Source References: PMID:3677168
Synonyms: unc-36(e873)/unc-32(e189) glp-1(q231) III.
Alternate IDs: WB-STRAIN:JK892, CGC_JK892
Notes: Heterozygotes are WT. At 25C hets segregate WT, Unc-36 and UncSterile and dead eggs. At 15C, hets segregate WT, Unc-36, dead eggs and Unc-32 (which are fertile and can be maintained as homozygous stock). e873 is aka eT1. Maintain by picking WT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.|"Made_by: Sandra Maples"
Proper citation: RRID:WB-STRAIN:WBStrain00022527 Copy
http://www.wormbase.org/db/get?name=WBStrain00022529
Source Database: WormBase (WB)
Affected Genes: WBGene00001609(glp-1)|WBGene00004937(sog-4)|WBGene00006768(unc-32)
Genomic Alteration: WBGene00001609(glp-1), WBGene00004937(sog-4), WBGene00006768(unc-32)
Availability: available
Source References: PMID:8307319
Synonyms: unc-32(e189) glp-1(q231) III; sog-4(q304) V.
Alternate IDs: WB-STRAIN:JK948, CGC_JK948
Notes: Unc. sog-4 suppresses glp-1 at or below 20C. Do not maintain above 20C. Some Glp dead embryos because suppression is incomplete. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
Proper citation: RRID:WB-STRAIN:WBStrain00022529 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
