Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00006510
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33820969
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ECA615
Notes: Added Wild_Isolate tag as Isolation information is available suggesting that they were sampled from the wild.
Proper citation: RRID:WB-STRAIN:WBStrain00006510 Copy
http://www.wormbase.org/db/get?name=WBStrain00006526
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33820969
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ECA714
Notes: Added Wild_Isolate tag as Isolation information is available suggesting that they were sampled from the wild.
Proper citation: RRID:WB-STRAIN:WBStrain00006526 Copy
http://www.wormbase.org/db/get?name=WBStrain00006525
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33820969
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ECA713
Notes: Added Wild_Isolate tag as Isolation information is available suggesting that they were sampled from the wild.
Proper citation: RRID:WB-STRAIN:WBStrain00006525 Copy
http://www.wormbase.org/db/get?name=WBStrain00006524
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33820969
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ECA712
Notes: Added Wild_Isolate tag as Isolation information is available suggesting that they were sampled from the wild.
Proper citation: RRID:WB-STRAIN:WBStrain00006524 Copy
http://www.wormbase.org/db/get?name=WBStrain00006522
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33820969, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ECA710
Notes: Added Wild_Isolate tag as Isolation information is available suggesting that they were sampled from the wild.
Proper citation: RRID:WB-STRAIN:WBStrain00006522 Copy
http://www.wormbase.org/db/get?name=WBStrain00006542
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33820969
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ECA730
Notes: Added Wild_Isolate tag as Isolation information is available suggesting that they were sampled from the wild.
Proper citation: RRID:WB-STRAIN:WBStrain00006542 Copy
http://www.wormbase.org/db/get?name=WBStrain00006539
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33820969
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ECA727
Notes: Added Wild_Isolate tag as Isolation information is available suggesting that they were sampled from the wild.
Proper citation: RRID:WB-STRAIN:WBStrain00006539 Copy
http://www.wormbase.org/db/get?name=WBStrain00006538
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33820969
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ECA726
Notes: Added Wild_Isolate tag as Isolation information is available suggesting that they were sampled from the wild.
Proper citation: RRID:WB-STRAIN:WBStrain00006538 Copy
http://www.wormbase.org/db/get?name=WBStrain00006534
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33820969, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ECA722
Notes: Added Wild_Isolate tag as Isolation information is available suggesting that they were sampled from the wild.
Proper citation: RRID:WB-STRAIN:WBStrain00006534 Copy
http://www.wormbase.org/db/get?name=WBStrain00006551
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33820969
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ECA739
Notes: Added Wild_Isolate tag as Isolation information is available suggesting that they were sampled from the wild.
Proper citation: RRID:WB-STRAIN:WBStrain00006551 Copy
http://www.wormbase.org/db/get?name=WBStrain00006549
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33820969
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ECA737
Notes: Added Wild_Isolate tag as Isolation information is available suggesting that they were sampled from the wild.
Proper citation: RRID:WB-STRAIN:WBStrain00006549 Copy
http://www.wormbase.org/db/get?name=WBStrain00006543
Source Database: WormBase (WB)
Availability: unknown
Source References: PMID:33820969
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:ECA731
Notes: Added Wild_Isolate tag as Isolation information is available suggesting that they were sampled from the wild.
Proper citation: RRID:WB-STRAIN:WBStrain00006543 Copy
http://www.wormbase.org/db/get?name=WBStrain00006685
Source Database: WormBase (WB)
Affected Genes: WBGene00000457(ceh-36)
Genomic Alteration: WBGene00000457(ceh-36)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:EG4168
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00006685 Copy
http://www.wormbase.org/db/get?name=WBStrain00006683
Source Database: WormBase (WB)
Affected Genes: WBGene00000086(aex-3)
Genomic Alteration: WBGene00000086(aex-3)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:EG3680
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00006683 Copy
http://www.wormbase.org/db/get?name=WBStrain00006682
Source Database: WormBase (WB)
Affected Genes: WBGene00000086(aex-3)
Genomic Alteration: WBGene00000086(aex-3)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:EG3346
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00006682 Copy
http://www.wormbase.org/db/get?name=WBStrain00006680
Source Database: WormBase (WB)
Affected Genes: WBGene00003553(nas-37)
Genomic Alteration: WBGene00003553(nas-37)
Availability: available
Source References: EMPTY
Synonyms: nas-37(tm410) X.
Alternate IDs: WB-STRAIN:EG3283, CGC_EG3283
Notes: At each molt the cuticle fails to open sufficiently at the anterior end and the partially shed cuticle is dragged behind the animal. Deletion. Flanking sequences: ttcttgtccagtagggtctagtcgtggttg tgaacttgcctgtcgatgtcttctggctga.|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00006680 Copy
http://www.wormbase.org/db/get?name=WBStrain00006678
Source Database: WormBase (WB)
Affected Genes: WBGene00006763(unc-26)
Genomic Alteration: WBGene00006763(unc-26)
Availability: available
Source References: PMID:35065714, PMID:37053235
Synonyms: unc-26(s1710) IV.
Alternate IDs: WB-STRAIN:EG3027, CGC_EG3027
Notes: Severe kinker. Small and scrawny with flaccid little movement. Slow pharyngeal pumping.
Proper citation: RRID:WB-STRAIN:WBStrain00006678 Copy
http://www.wormbase.org/db/get?name=WBStrain00006675
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: oxEx344.
Alternate IDs: WB-STRAIN:EG2537, CGC_EG2537
Notes: oxEx344 [MosPolyA substrate + myo-2::GFP]. Should be grown at 25C.
Proper citation: RRID:WB-STRAIN:WBStrain00006675 Copy
http://www.wormbase.org/db/get?name=WBStrain00006695
Source Database: WormBase (WB)
Availability: unknown
Source References: EMPTY
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:EG4680
Notes: Landscape: Urban_land
Proper citation: RRID:WB-STRAIN:WBStrain00006695 Copy
http://www.wormbase.org/db/get?name=WBStrain00006691
Source Database: WormBase (WB)
Availability: available
Source References: PMID:33820969, PMID:37221008, PMID:38564369
Synonyms: Caenorhabditis elegans wild isolate.
Alternate IDs: WB-STRAIN:EG4349, CGC_EG4349
Notes: Maintain under normal conditions. Reference: Andersen EC, Nat Genet. 2012 Jan 29;44(3):285-90.
Proper citation: RRID:WB-STRAIN:WBStrain00006691 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
