Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
rps-10(srf1025[rps-10::3xHA]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055659 | Caenorhabditis elegans | rps-10(srf1025[rps-10::3xHA]) I. | 3xHA tag inserted at C-terminus of endogenous rps-10 locus. Some growth defects on its own, which can be exacerbated in conjunction with mutants of no-go mRNA decay factors. Reference: Monem PC et al. PLOS Genet. 2023 Jan 10;19(1):e1010577. doi: 10.1371/journal.pgen.1010577. PMID: 36626369|"Made_by: Parissa Monem" | WBGene00004479(rps-10) | WBGene00004479(rps-10) | WB-STRAIN:WBStrain00055659 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:46 | 0 | ||||
|
cwEx486. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055656 | Caenorhabditis elegans | cwEx486. | cwEx486 [mnp-1p::mnp-1::GFP + rol-6(su1006)]. Pick Rollers to maintain. Generated in N2 background. | WB-STRAIN:WBStrain00055656 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:46 | 0 | ||||||
|
mnp-1(gm85) III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055655 | Caenorhabditis elegans | mnp-1(gm85) III. | Unc. Sma. Reference: Craft TR & Forrester WC. Dev Biol.2017 Apr 1;424(1):18-27. PMID: 28238735 | WBGene00007139(mnp-1) | WBGene00007139(mnp-1) | WB-STRAIN:WBStrain00055655 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:47 | 0 | ||||
|
glh-1(how3[3xHA::TurboID::glh-1]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055657 | Caenorhabditis elegans | glh-1(how3[3xHA::TurboID::glh-1]) I. | 3xHA::TurboID tag inserted at the N-terminus of the endogenous GLH-1. TurboID::GLH-1 promiscuously labels proteins at 20C. Transgene generated in N2 background. Reference: Price I, et al. ELife. 2021 Nov 3;10:e72276. doi: 10.7554/eLife.72276. | WBGene00001598(glh-1) | WBGene00001598(glh-1) | WB-STRAIN:WBStrain00055657 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:48 | 0 | ||||
|
drl-1(hd7062[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055641 | Caenorhabditis elegans | drl-1(hd7062[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ IV. | Heterozygous strain, might not be homozygous viable. Deletion of 1309 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGTTTGAATTGAAAAGGGAGTGGTTTCCCT; Right flanking sequence: CGGCATTGAGTCTGGCGGCTGTTGCCGGTG. sgRNA #1: CCGATTCCGTTCCTAATCAC; sgRNA #2: GATTGGAATGGTGTTATGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00017578(drl-1) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00017578(drl-1) | WB-STRAIN:WBStrain00055641 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:46 | 0 | ||||
|
F10E9.4(hd7061[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ III. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055640 | Caenorhabditis elegans | F10E9.4(hd7061[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ III. | Heterozygous strain, might not be homozygous viable. Deletion of 1418 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAACGAGGATGGAACTACAGAAGTCCAGGA; Right flanking sequence: AGGATATTGATCTCAATAGCTCCAATTAAA. sgRNA #1: AACAGAAAGTGAAGCACCAA; sgRNA #2: ATTATGACTATGTACTTCCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00055640 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:46 | 0 | ||||
|
kin-14(hd7063[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055642 | Caenorhabditis elegans | kin-14(hd7063[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. | Homozygous viable. Deletion of 2852 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GATGGAAGTTTCGCCCAGCATTGTTTCAAA; Right flanking sequence: TGGCAGTTACAGTTAAGTTACAATATTTGG. sgRNA #1: GCGATTTCAGAAATGGTTGG; sgRNA #2: CAACGAAATTTGGCGCTGTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group" | WBGene00002198(kin-14)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00002198(kin-14), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00055642 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:48 | 0 | ||||
|
hda-5(hd7070[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055648 | Caenorhabditis elegans | hda-5(hd7070[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. | Homozygous viable. Deletion of 2776 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACATATACCTATTTTCTCCTTGTTTTCCCC; Right flanking sequence: TGGAAAGATCCTCGCTATATTAGAAGGTGG. sgRNA #1: TGATGTTTGACCGATTATGG; sgRNA #2: CTCCTCAGCCAAATTTGCCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00009663(hda-5) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00009663(hda-5) | WB-STRAIN:WBStrain00055648 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:48 | 0 | ||||
|
pph-1(hd7066[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055645 | Caenorhabditis elegans | pph-1(hd7066[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. | Homozygous viable. Deletion of 2500 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GTATTTTTTCGTTTTCAAAAAATAGTACCG; Right flanking sequence: CTGTCCCGGGTCCTTTCTTTTCTCCCGATT. sgRNA #1: CCTAGGTATTTTTGTTTTCT; sgRNA #2: CCCTTCAAACCATCACTTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group" | WBGene00003514(myo-2)|WBGene00004083(pph-1)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004083(pph-1), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00055645 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:48 | 0 | ||||
|
Y51B9A.9(hd7068[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055647 | Caenorhabditis elegans | Y51B9A.9(hd7068[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. | Homozygous viable. Deletion of 1571 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGCCCAAATTCGGTCAGTGTACTGAAAATC; Right flanking sequence: CAATAATGCTGAGGAAAAAAGCTTCGAATA. sgRNA #1: TCATCCTTCATTTGTCTGGG; sgRNA #2: GAATTTTCAGGCAACACTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group" | WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00055647 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:46 | 0 | ||||
|
asp-3(hd7060[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055639 | Caenorhabditis elegans | asp-3(hd7060[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. | Homozygous viable. Deletion of 2624 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGAGCATGATGAACTTGATGAGATAAACTG; Right flanking sequence: CGGAGGACAAAACTTCGATCTTCAAGGAAA. sgRNA #1: CTTGATGAGATAAACTGATG; sgRNA #2: AACATCACCTTCAACCTCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group" | WBGene00000216(asp-3)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54) | WBGene00000216(asp-3), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54) | WB-STRAIN:WBStrain00055639 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:48 | 0 | ||||
|
ego-1(fj114[PA::ego-1]) I. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055737 | Caenorhabditis elegans | ego-1(fj114[PA::ego-1]) I. | Four amino-acid residues (G24V27) near the N-terminus of EGO-1 were replaced with a PA-tag sequence (GVAMPGAEDDVV derived from human podoplanin) in the endogenous ego-1 gene. The PA-tag insertion can be checked by PCR with the following primers: TTCAAAATGCCGCTGCCTTC and GTCCTCTTCGCATCTTTATCAG, followed by digestion with Sau96I. The wild-type ego-1 gene contains a Sau96I site within its PCR region, while the PA-tagged ego-1 does not. This strain was used for immunofluorescence analysis of EGO-1. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002. | WBGene00001214(ego-1) | WBGene00001214(ego-1) | WB-STRAIN:WBStrain00055737 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:47 | 0 | ||||
|
dpy-5(e61) I; fjDf1 fjDf2 fjDf3 fjDf4 X. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055739 | Caenorhabditis elegans | dpy-5(e61) I; fjDf1 fjDf2 fjDf3 fjDf4 X. | This strain carries a dpy-5 mutation to facilitate genome modification in CeRep55 quadruple deletion background: fjDf1 (also known as fj115); fjDf2 (aka fj85); fjDf3 (aka fj123); fjDf4 (aka fj120) X. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA. The PCR check can also be performed with the M13 reverse primer and the right-side primer. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.|"This strain carries a dpy-5 mutation to facilitate genome modification in CeRep55 quadruple deletion background: fjDf1 (also known as fj115); fjDf2 (aka fj85); fjDf3 (aka fj123); fjDf4 (aka fj120) X. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CTCTTCCATTTCCAGTACAACCAG and GTTTCTATGGCTAGAGTCGTATGGTTAC. The PCR check can also be performed with the M13 reverse primer and the right-side primer. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002." | WBGene00001067(dpy-5) | WBGene00001067(dpy-5) | WB-STRAIN:WBStrain00055739 | WormBase (WB) | WB | unknown | 2026-08-01 10:24:48 | 0 | ||||
|
cylc-2(mon2); spe-36(as6);him-5(e1490); asEx96 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055794 | Caenorhabditis elegans | cylc-2(mon2); spe-36(as6);him-5(e1490); asEx96 | EMPTY | WB-STRAIN:WBStrain00055794 | WormBase (WB) | WB | unknown | PMID:37453426 | 2026-08-01 10:24:48 | 0 | |||||
|
spe-36(nwk1[spe-36::gfp]) IV; him-5(e1490) V. Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055797 | Caenorhabditis elegans | spe-36(nwk1[spe-36::gfp]) IV; him-5(e1490) V. | GFP tag inserted into endogenous spe-36 (F40F11.4) locus. SPE-36::GFP expression in spermatids and spermatozoa. Reference: Krauchunas AR, et al. Curr Biol. 2023 Jul 24;33(14):3056-3064.e5. doi: 10.1016/j.cub.2023.06.051. PMID: 37453426. | WBGene00001864(him-5)|WBGene00009589(spe-36) | WBGene00001864(him-5), WBGene00009589(spe-36) | WB-STRAIN:WBStrain00055797 | WormBase (WB) | WB | unknown | PMID:37453426 | 2026-08-01 10:24:48 | 0 | |||
|
spe-36(as6); him-5(e1490); asEx96 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055796 | Caenorhabditis elegans | spe-36(as6); him-5(e1490); asEx96 | EMPTY | WB-STRAIN:WBStrain00055796 | WormBase (WB) | WB | unknown | PMID:37453426 | 2026-08-01 10:24:49 | 0 | |||||
|
glp-4(bn2);him-5(e1490) Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055790 | Caenorhabditis elegans | glp-4(bn2);him-5(e1490) | EMPTY | WB-STRAIN:WBStrain00055790 | WormBase (WB) | WB | unknown | PMID:37453427 PMID:37453426 |
2026-08-01 10:24:49 | 0 | |||||
|
syp-3 (ok857) I; ieSi64[gld-1p::TIR1::mRuby::gld-1 3'UTR, Cbr-unc-119(+)] II; unc-119(ed3) III; ieSi19 (mRuby::SYP-3),ojIs9 [zyg-12(all)::GFP + unc-119(+)] IV; sun-1(ie139[sun-1::AID::V5]) V Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055832 | Caenorhabditis elegans | syp-3 (ok857) I; ieSi64[gld-1p::TIR1::mRuby::gld-1 3'UTR, Cbr-unc-119(+)] II; unc-119(ed3) III; ieSi19 (mRuby::SYP-3),ojIs9 [zyg-12(all)::GFP + unc-119(+)] IV; sun-1(ie139[sun-1::AID::V5]) V | EMPTY | WB-STRAIN:WBStrain00055832 | WormBase (WB) | WB | unknown | PMID:37436986 | 2026-08-01 10:24:50 | 0 | |||||
|
hpl-2(tm1489) x TJ356 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055798 | Caenorhabditis elegans | hpl-2(tm1489) x TJ356 | EMPTY | WB-STRAIN:WBStrain00055798 | WormBase (WB) | WB | unknown | PMID:37454110 | 2026-08-01 10:24:49 | 0 | |||||
|
asEx106[vit-2p::tmem95::gfp;rps-0p::HygR]#3 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00055783 | Caenorhabditis elegans | asEx106[vit-2p::tmem95::gfp;rps-0p::HygR]#3 | EMPTY | WB-STRAIN:WBStrain00055783 | WormBase (WB) | WB | unknown | PMID:37453427 | 2026-08-01 10:24:49 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
