SYSTEM UPDATE: We will be performing system maintenace Saturday September 26 at 9pm to midnight Pacific Time

Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Background:mutant (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

1,458 Results - per page

Show More Columns | Download Top 1000 Results

Organism Name Proper Citation Species Synonyms Notes Phenotype Affected Gene Genomic Alteration Catalog Number Background Database Database Abbreviation Availability Source References Alternate IDs Authority Record Last Update Mentions Count
SS-Tfdp2em2Mcwi-/-
 
Resource Report
Resource Website
RRID:RGD_5688111 Rattus norvegicus ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5688111 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2018-09-05) 5688111 RGD 2026-09-19 01:18:39 0
SS-Abcb1bem2Mcwi
 
Resource Report
Resource Website
RRID:RGD_6893600 Rattus norvegicus This strain was produced by injecting ZFNs targeting the sequence GAAAGCTGCCCACCTCATGgatgtgGCCGGAAACAAGGTGGGA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 98-bp frameshift deletion in exon 4. 6893600 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2017-07-24) 6893600 RGD 2026-09-19 01:18:39 0
SS-Plod1em1Mcwi-/-
 
Resource Report
Resource Website
RRID:RGD_5686762 Rattus norvegicus ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686762 mutant Rat Genome Database (RGD) RGD Cryorecovery (as of 2018-09-05) 5686762 RGD 2026-09-19 01:18:39 0
SS-Plekha7em4Mcwi+/+
 
Resource Report
Resource Website
RRID:RGD_5686760 Rattus norvegicus ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686760 mutant Rat Genome Database (RGD) RGD Unknown 5686760 RGD 2026-09-19 01:18:39 0
SS-Fynem1Mcwi
 
Resource Report
Resource Website
RRID:RGD_6893440 Rattus norvegicus This strain was produced by injecting ZFNs targeting the sequence TCCATCCCGAACTACAACaacttcCACGCAGCCGGGGGCCAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp deletion in exon 4. 6893440 mutant Rat Genome Database (RGD) RGD Extinct 6893440 RGD 2026-09-19 01:18:39 0
SS-Plekha7em4Mcwi-/-
 
Resource Report
Resource Website
RRID:RGD_5686758 Rattus norvegicus ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders. 5686758 mutant Rat Genome Database (RGD) RGD Live Animals; Cryopreserved Sperm (as of 2018-09-05) 5686758 RGD 2026-09-19 01:18:39 0
(SDxF344)F1-Rbm20m1Mlgw+/+
 
Resource Report
Resource Website
RRID:RGD_7241596 Rattus norvegicus Heterozygous offsprings were intercrossed and maintained as wild type 7241596 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm 7241596 RGD 2026-09-19 01:18:40 0
(SDxF344)F1xBN-Rbm20m1Mlgw+/+
 
Resource Report
Resource Website
RRID:RGD_7241595 Rattus norvegicus Heterozygous offspring were intercrossed and maintained as wild type 7241595 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm 7241595 RGD 2026-09-19 01:18:40 0
(SDxF344)F1-Rbm20m1Mlgw
 
Resource Report
Resource Website
RRID:RGD_7241594 Rattus norvegicus This mutation, a deletion in chromosome 1 between bp 260,070,892 and 260,166,363, was originally found in the offspring of Hsd:SD x Hsd:SD. The phenotype was an altered titin isoform expression in the offspring. The parent carrier was identified by crossing both the male and the female Hsd:SD with F344/NHsd. This mutation is maintained on Hsd:SD X F344/NHsd. 7241594 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2017-01-25) 7241594 RGD 2026-09-19 01:18:40 0
(SDxF344)F1xBN-Rbm20m1Mlgw
 
Resource Report
Resource Website
RRID:RGD_7241597 Rattus norvegicus This mutation, a deletion in chromosome 1 between bp 260,070,892 and 260,166,363, was originally found in the offspring of Hsd:SD x Hsd:SD. The phenotype was an altered titin isoform expression in the offspring. The parent carrier was identified by crossing both the male and the female Hsd:SD with F344/NHsd. This mutation is maintained on Hsd:SD X F344/NHsd. 7241597 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2017-01-25) 7241597 RGD 2026-09-19 01:18:40 0
WDB-ROSA26em1(RT2)Nips
 
Resource Report
Resource Website
RRID:RGD_8552371 Rattus norvegicus This strain was produced by knock-in in the rat ROSA26 locus using the construct 5' arm--tdTomato--IRES-Puro^r-pA--3' arm (11 kb) to the WDB/Nips strain. ROSA26 is a synonym for rat Thumpd3-as1 (RGD:6491660) and is used as an official symbol for rat strain nomenclature. Section of Mammalian Transgenesis Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, Okazaki Aichi, JAPAN 8552371 mutant Rat Genome Database (RGD) RGD Unknown 8552371 RGD 2026-09-19 01:18:40 0
LE-Pink1em1Sage-/-
 
Resource Report
Resource Website
RRID:RGD_7241049 Rattus norvegicus ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offspring which were intercrossed and offspring maintained as homozygous. This allele was made by ZFN mutagenesis. The resulting mutation is a 26-bp frameshift deletion in exon 4 (ACTACTACCCAGAAGGCCTGGGCCAC). inotiv 7241049 mutant Rat Genome Database (RGD) RGD Live Animals (as of 2024-11-26) 7241049 RGD 2026-09-19 01:18:41 0
LE-Park7em1Sage
 
Resource Report
Resource Website
RRID:RGD_7241048 Rattus norvegicus This strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 9-bp deletion with 1-bp insertion in exon 5 Sigma Advanced Genetic Engineering Labs 7241048 mutant Rat Genome Database (RGD) RGD Unknown 7241048 RGD 2026-09-19 01:18:41 0
LE-Lrrk1em1SageLrrk2em1Sage
 
Resource Report
Resource Website
RRID:RGD_7241047 Rattus norvegicus This strain was produced by crossing LE-Lrrk1em1Sage with LE-Lrrk2em1Sage Horizon Discovery 7241047 mutant Rat Genome Database (RGD) RGD Cryopreserved Embryo (as of 2017-06-06) 7241047 RGD 2026-09-19 01:18:41 0
KHR/Kyo-/-
 
Resource Report
Resource Website
RRID:RGD_7800702 Rattus norvegicus Kaken hairless rat were detected by Kimura from Gunn's rat at Kaken Pharmaceuticals in 1987. 2002 introduced to Kyoto University (F36). National BioResource Project for the Rat in Japan 7800702 mutant Rat Genome Database (RGD) RGD Cryopreserved Embryo; Cryopreserved Sperm 7800702 RGD 2026-09-19 01:18:40 0
SS-Slc7a9em1Mcwi
 
Resource Report
Resource Website
RRID:RGD_7364881 Rattus norvegicus This strain was produced by injecting ZFNs targeting the sequence ATCGTCGCCATCATCATCatcagcGGACTGGTCCTCCTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 7-bp frameshift deletion in exon 6. 7364881 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2017-01-26) 7364881 RGD 2026-09-19 01:18:42 0
SS-Sorcs2em1Mcwi
 
Resource Report
Resource Website
RRID:RGD_7364882 Rattus norvegicus This strain was produced by injecting ZFNs targeting the sequence ATCGTCGCCATCATCATCatcagcGGACTGGTCCTCCTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 34-bp frameshift deletion in exon 15. 7364882 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2017-01-26) 7364882 RGD 2026-09-19 01:18:42 0
SS-Cst3em1Mcwi
 
Resource Report
Resource Website
RRID:RGD_7364880 Rattus norvegicus This strain was produced by injecting ZFNs targeting the sequence CTTCGCCGTAAGCGAGTAcaacaaGGGCAGCAACGAT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 18-bp deletion in exon 1. 7364880 mutant Rat Genome Database (RGD) RGD Cryopreserved Sperm (as of 2017-01-26) 7364880 RGD 2026-09-19 01:18:42 0
LE-Park7em1Sage-/-
 
Resource Report
Resource Website
RRID:RGD_7241055 Rattus norvegicus ZFN mutant founders were backcrossed with Crl:LE to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous. The resulting mutation is a 9-bp deletion with 1-bp insertion in exon 5 (TTGGTGAAGA). Horizon Discovery 7241055 mutant Rat Genome Database (RGD) RGD Live Animals (as of 2017-05-08) 7241055 RGD 2026-09-19 01:18:41 0
LE-Prknem1Sage
 
Resource Report
Resource Website
RRID:RGD_7241058 Rattus norvegicus This strain was produced by injecting ZFNs into Crl:LE rat embryos. The resulting mutation is a 5-bp frameshift deletion in exon 4. Sigma Advanced Genetic Engineering Labs 7241058 mutant Rat Genome Database (RGD) RGD Unknown 7241058 RGD 2026-09-19 01:18:41 0

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.