Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
LCR/Tol Resource Report Resource Website |
RRID:RGD_39457699 | Rattus norvegicus | Artificially selected for aerobic running capacity from the genetic heterogenous rats; these were selected for low capacity based on distance run to exhaustion on a motorized treadmill. | 39457699 | inbred | Rat Genome Database (RGD) | RGD | Unknown | 39457699 | 2026-08-01 12:40:44 | 0 | |||||
|
W-Cyp27b1em1Thka Resource Report Resource Website |
RRID:RGD_124713544 | Rattus norvegicus | This strain was established by injecting Jcl:Wistar embryo with CRISPR/Cas9 system to delete the cysteine at position 462 in exon 8, which is the 5th ligand of heme iron and an active center of Cyp27b1. The resulting mutation is a 25 amino acid deletion (75 bp deletion) in the target site. The mutant was maintained with CE-2 formula diet (CLEA Japan, Inc., Tokyo, Japan) containing 1.15% calcium and 2,100 IU vitamin D3/kg diet. Homozygotes Cyp27b1 mutants were maintained by mating of heterozygotes. | 124713544 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 124713544 | 2026-08-01 12:40:45 | 0 | |||||
|
SD-Shank2em13Sage Resource Report Resource Website |
RRID:RGD_126790496 | Rattus norvegicus | The Shank2 KO rat line 13 was generated by zinc finger nuclease technology targeting exon 31 for deletion . Line 13 has a 437 bp deletion around and including the entire exon 31, thereby causing a frameshift and premature stop codon in all three known isoforms of the rat Shank2 mRNA | 126790496 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 126790496 | 2026-08-01 12:40:44 | 0 | |||||
|
W-Vdrem2Thka Resource Report Resource Website |
RRID:RGD_124713548 | Rattus norvegicus | This strain was established by injecting Jcl:Wistar embryo with CRISPR/Cas9 system to disrupt the array near the arginine codon (CGC) at position 270 of the Vdr gene. This resulted in 1bp deletion and caused premature stop at p266 of the Vdr gene. They were allowed food and water ad libitum and fed a CE-2 formula diet ( CLEA Japan, Inc., Tokyo, Japan) containing 1.15% calcium and 2,100 IU vitamin D3/kg diet. The Vdr knock out rats for analysis were fed an F-2 formula diet (Oriental Yeast Co., Tokyo, Japan) containing 0.74% calcium and 2000 IU vitamin D/kg diet12 after weaning because the CE-2diet partially reversed their rickets symptoms. Homozygotes Vdr knock out mutants were maintained by mating of heterozygotes. | 124713548 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 124713548 | 2026-08-01 12:40:45 | 0 | |||||
|
Alpha IIM Resource Report Resource Website |
RRID:RGD_40924650 | Rattus norvegicus | Nine inbred lines developed from random-bred colony maintained by B. Houssay since 1948. Inbreeding and upward selection of body weight and fertility were performed in every line. Groups of rats from lines 'b' and 'alpha' were separated in 1958 and 1972 respectively and raised at the School of Medicine at Rosario. This line alpha (Alpha IIM) ), obtained from the F1 'a' X 'd', was used as control for the obese Beta line (RGD:40924649). | 40924650 | inbred | Rat Genome Database (RGD) | RGD | Unknown | 40924650 | 2026-08-01 12:40:44 | 0 | |||||
|
HXB20/IpcvMcwi Resource Report Resource Website |
RRID:RGD_149735521 | Rattus norvegicus | These are re-derived rats of HXB20/Ipcv now maintained at Medical College of Wisconsin. The parent strain wasDerived from founder strains SHR/OlaIpcv and BN-Lx/Cub RGD HRDP, contact HRDP | 149735521 | recombinant_inbred | Rat Genome Database (RGD) | RGD | Unknown | 149735521 | 2026-08-01 12:40:45 | 0 | |||||
|
SD-Cd59em1Ask-/- Resource Report Resource Website 1+ mentions |
RRID:RGD_13792606 | Rattus norvegicus | The CRISPR/Cas9 genome editing system was used to generate Cd59 mutation in the Sprague Dawley embryos. The CRISPR/Cas9 targeting exon 3 of the rat Cd59 created a 11 bp-deletion (TGCAAAACAAA) in exon 3. No protein expression was detected in the blood smear of homozygous mutants. | 13792606 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 13792606 | 2026-08-01 12:40:44 | 1 | |||||
|
SD-Leprem4Lizh Resource Report Resource Website |
RRID:RGD_21079475 | Rattus norvegicus | The Lepr knockout rats were generated by CRISPR/Cas9. Two pairs of synthesized oligonucleotides for gRNA targeting on the exon 4 of Lepr, TAGGCAAATCATCTATAACTTC and AAACGAAGTTATAGATGATTTG; TAGGCTGAAAGCTGTCTTTCAG and AAACCTGAAAGACAGCTTTCAG were microinjected into Sprague Dawley (originally from Charles River) zygotes. The rat was genotyped by PCR with the primers, 5-prime-CTTGTGTCCAGAGCCTTCCTATAAC and 5-prime-ATTCCCCATGTTGTCTAGTAGTGATC. For genotyping, a 662-bp fragment of WT and a 368-bp fragment of the Lepr knockout gene were amplified with PCR. Founder 2 was chosen to establish a colony (designated as Lepr-/-), which carried a 298-bp deletion from No. 90043 bp to 90341 bp in the Lepr genome DNA sequence (NC_005104.4) and a 4-bp insertion and resulted in a termination codon TGA, deleting 997 amino acid of LEPR. Western blot analysis of total protein from liver tissue of the Lepr-/- rats confirmed the absence of LEPR. | 21079475 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 21079475 | 2026-08-01 12:40:45 | 0 | |||||
|
SD-Abcc6em2Qlju+/- Resource Report Resource Website |
RRID:RGD_13792682 | Rattus norvegicus | This strain was produced by injecting ZFNs into SD embryos. ZFNs were designed to target exon 1 of rat Abcc6 gene at the binding site/cutting site 5-CACGCCTGGAGAGTCCTGcgcaggCCTGAGGGTGAGTCC-3 (c.24-c.62). The resulting mutation is a 23 bp-deletion (TGCGCAGGCCTGAGGGTGAGTCC) from the first coding exon of the rat Abcc6 gene. The mutation is predicted to cause out of frame translation and a premature stop codon. No protein in the homozygous mutant was detected by immunostaining. | 13792682 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 13792682 | 2026-08-01 12:40:44 | 0 | |||||
|
MWF.SHR-(D6Rat1-D6Rat106)/Rkb Resource Report Resource Website |
RRID:RGD_150429602 | Rattus norvegicus | The congenic MWF.SHR-(D6Rat1-D6Rat106)/Rkb was generated by transfer of different nested SHR/FubRkb segments onto the MWF/FubRkb background. For this procedure, male and female rats of the MWF-6SHR (RGD:1641831) breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed. Eight congenics were generated. | 150429602 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 150429602 | 2026-08-01 12:40:44 | 0 | |||||
|
MWF.SHR-(D6Rat1-D6Rat30)/Rkb Resource Report Resource Website |
RRID:RGD_150429601 | Rattus norvegicus | The congenic MWF.SHR-(D6Rat1-D6Rat30)/Rkb was generated by transfer of different nested SHR/FubRkb segments onto the MWF/FubRkb background. For this procedure, male and female rats of the MWF-6SHR (RGD:1641831) breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed. Eight congenics were generated. | 150429601 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 150429601 | 2026-08-01 12:40:44 | 0 | |||||
|
WI-Pmchm1Hubr Resource Report Resource Website |
RRID:RGD_150429963 | Rattus norvegicus | The Pmch mutant rat line was generated by target-selected ENU-driven mutagenesis, and high-throughput resequencing of genomic target sequences in progeny from mutagenized rats (Wistar/Crl background) revealed an ENU-induced premature stop codon in exon 1(K50X) of Pmch in a rat. The heterozygous mutant rat was backcrossed to wild-type Wistar background for six generations to eliminate confounding effects from background mutations induced by ENU. | 150429963 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 150429963 | 2026-08-01 12:40:45 | 0 | |||||
|
LEXF10A/StmMcwi Resource Report Resource Website |
RRID:RGD_149735517 | Rattus norvegicus | These are re-derived rats of LEXF10A/Stm now maintained at Medical College of Wisconsin. The parent strain was derived from systematic breeding of the F2 generation between LE/Stm and F344/DuCrlj. RGD HRDP, contact HRDP | 149735517 | recombinant_inbred | Rat Genome Database (RGD) | RGD | Unknown | 149735517 | 2026-08-01 12:40:44 | 0 | |||||
|
MWF.SHR-(D6Rat1-D6Rat184)/Rkb Resource Report Resource Website |
RRID:RGD_150429608 | Rattus norvegicus | The congenic MWF.SHR-(D6Rat1-D6Rat184)/Rkb was generated by transfer of different nested SHR/FubRkb segments onto the MWF/FubRkb background. For this procedure, male and female rats of the MWF-6SHR (RGD:1641831) breeding, that were homozygous for all MWF chromosomes except RNO6 and heterozygous for RNO6, were intercrossed. Eight congenics were generated. | 150429608 | congenic | Rat Genome Database (RGD) | RGD | Unknown | 150429608 | 2026-08-01 12:40:44 | 0 | |||||
|
LEW-Glp1rem1Mcwi Resource Report Resource Website |
RRID:RGD_13800749 | Rattus norvegicus | CRISPR/Cas9 system was used to introduce a 84-bp deletion and skipping of exon 5 of the Glp1r gene in Lew/NCrl embryos. Contact MCW rat distribution at [email protected] | 13800749 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 13800749 | 2026-08-01 12:40:44 | 0 | |||||
|
WI-Mc4rm1Hubr Resource Report Resource Website |
RRID:RGD_13825199 | Rattus norvegicus | The Mc4r mutant rat line was generated by target-selected ENU-driven mutagenesis, and high-throughput resequencing of genomic target sequences in progeny from mutagenized rats (Wistar/Crl background) revealed an ENU-induced premature stop codon in helix 8 (K314X) of Mc4r. The heterozygous mutant rat was backcrossed to wild-type Wistar background for six generations to eliminate confounding effects from background mutations induced by ENU. | 13825199 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 13825199 | 2026-08-01 12:40:44 | 0 | |||||
|
SD-Fahem15Dlli-/- Resource Report Resource Website |
RRID:RGD_14398825 | Rattus norvegicus | This strain was produced by injecting Sprague Dawley embryo with CRISPR/Cas9 system targeting the exon 2 of rat Fah gene. The resulting mutation is line 15 with a frameshift deletion causing Fah null in homozygotes. None of the Fah-/- newborns survived longer than three days after birth in the absence of NTBC. Upon NTBC addition to the drinking water, the Fah-/- rats underwent normal growth and were indistinguishable from their WT littermates. | 14398825 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 14398825 | 2026-08-01 12:40:44 | 0 | |||||
|
LOU/C Resource Report Resource Website |
RRID:RGD_38456008 | Rattus norvegicus | Bazin and Beckers from rats of presumed Wistar origin kept at the Universite Catholique de Louvain. LOU/C was selected among 28 parallel sublines for its high incidence of immunocytomas, and LOU/M for its low incidence. The two are histocomaptible (Bazin 1977, Bazin and Beckers 1978). | 38456008 | inbred | Rat Genome Database (RGD) | RGD | Unknown | 38456008 | 2026-08-01 12:40:46 | 0 | |||||
|
SD-Cryba1Nuc1Dbsa Resource Report Resource Website |
RRID:RGD_126925756 | Rattus norvegicus | This spontaneous mutation was identified in the offspring of pregnant Sprague-Dawley rats purchased from Taconic Farms. This mutant exhibited abnormal eye phenotype including nuclear cataracts and was called Nuc1 rat. Sequencing of the mutant allele revealed a 27 base pair insertion in exon 6 of Cryba1. | 126925756 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 126925756 | 2026-08-01 12:40:46 | 0 | |||||
|
SHR-Gja8m1+/-Cub Resource Report Resource Website |
RRID:RGD_150520205 | Rattus norvegicus | This strain is derived from SHR/OlaIpcv where a spontaneous mutation was observed in the NH2-terminal cytosolic domain of Cx50, L7Q. The connexin50 mutation in heterozygous state affects significantly the lipid profile and the oxidative stress parameters in SHR rats. | 150520205 | mutant | Rat Genome Database (RGD) | RGD | Unknown | 150520205 | 2026-08-01 12:40:46 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
