Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00022290
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Synonyms: unc-119(ed3) III; axIs1609.
Alternate IDs: WB-STRAIN:JH2221, CGC_JH2221
Notes: axIs1609 [pie-1p::GFP::histone H2B::mex-5 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.|"Made_by: Chris Meritt"
Proper citation: RRID:WB-STRAIN:WBStrain00022290 Copy
http://www.wormbase.org/db/get?name=WBStrain00022291
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Synonyms: unc-119(ed3) III; axIs1611.
Alternate IDs: WB-STRAIN:JH2223, CGC_JH2223
Notes: axIs1611 [pie-1p::GFP::histone H2B::daz-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.|"Made_by: Chris Meritt"
Proper citation: RRID:WB-STRAIN:WBStrain00022291 Copy
http://www.wormbase.org/db/get?name=WBStrain00022204
Source Database: WormBase (WB)
Affected Genes: WBGene00001073(dpy-11)|WBGene00010283(ccz-1)
Genomic Alteration: WBGene00001073(dpy-11), WBGene00010283(ccz-1)
Availability: available
Synonyms: dpy-11(e224) ccz-1(t2129) V; jcpEx2.
Alternate IDs: WB-STRAIN:JCP152, CGC_JCP152
Notes: jcpEx2 [ced-1p::F58G11.6(genomic)::YFP::let-858 3'UTR + unc-119(+) + myo-2::GFP]. Maintain by picking GFP+. Individuals that lost the array produce only arrested embryos with spindle orientation defects, accumulate vesicles, and problems engulfing apoptotic corpses. Reference: Nieto C, et al. J Cell Sci. 2010 Jun 15;123(Pt 12):2001-7.
Proper citation: RRID:WB-STRAIN:WBStrain00022204 Copy
http://www.wormbase.org/db/get?name=WBStrain00022207
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Synonyms: jcpSi3 II; unc-119(ed3) III.
Alternate IDs: WB-STRAIN:JCP301, CGC_JCP301
Notes: jcpSi3 [ins-37p::ins-37::eGFP::ins-37 3'UTR + unc-119(+)] II. Superficially wild-type. Reference: Gmez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.|"Made_by: Knudra Nemametrix"
Proper citation: RRID:WB-STRAIN:WBStrain00022207 Copy
http://www.wormbase.org/db/get?name=WBStrain00022206
Source Database: WormBase (WB)
Affected Genes: WBGene00000994(ints-6)
Genomic Alteration: WBGene00000994(ints-6)
Availability: available
Synonyms: ints-6(t1903) IV.
Alternate IDs: WB-STRAIN:JCP294, CGC_JCP294
Notes: Made_by: Ralf Schnabel, Juan Cabello|"Temperature-sensitive. Grows well at 15C; embryonic lethal at 25C. ints-6 previously known as dic-1. Reference: Gmez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981."
Proper citation: RRID:WB-STRAIN:WBStrain00022206 Copy
http://www.wormbase.org/db/get?name=WBStrain00022209
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Synonyms: jcpSi12 II; unc-119(ed3) III.
Alternate IDs: WB-STRAIN:JCP343, CGC_JCP343
Notes: jcpSi12 [W04G5.8p::W04G5.8::eGFP::W04G5.8 3'UTR + unc-119(+)] II. Superficially wild-type. Reference: Gmez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.|"Made_by: Knudra Nemametrix"
Proper citation: RRID:WB-STRAIN:WBStrain00022209 Copy
http://www.wormbase.org/db/get?name=WBStrain00022285
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: PMID:37467327, PMID:37505984, PMID:37995185, PMID:39167497
Synonyms: unc-119(ed3) III; axIs1595.
Alternate IDs: WB-STRAIN:JH2184, CGC_JH2184
Notes: axIs1595 [pie-1p::GFP::npp-9(orf )::npp-9 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Reference: Voronina E & Seydoux G, Development. 2010 May;137(9):1441-50.|"Made_by: E Voronina"|"Supplementary_genotype GFP-NPP-9; axIs1595 [pie-1p:GFP:npp-9(orf):npp-9 3UTR + unc-119(+)]"
Proper citation: RRID:WB-STRAIN:WBStrain00022285 Copy
http://www.wormbase.org/db/get?name=WBStrain00022289
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Synonyms: unc-119(ed3) III; axIs1608.
Alternate IDs: WB-STRAIN:JH2220, CGC_JH2220
Notes: axIs1608 [pie-1p::GFP::histone H2B::par-5 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.|"Made_by: Chris Meritt"
Proper citation: RRID:WB-STRAIN:WBStrain00022289 Copy
http://www.wormbase.org/db/get?name=WBStrain00022202
Source Database: WormBase (WB)
Affected Genes: WBGene00002044(hyl-2)
Genomic Alteration: WBGene00002044(hyl-2)
Availability: available
Synonyms: hyl-2(gnv1) X.
Alternate IDs: WB-STRAIN:JCM1, CGC_JCM1
Notes: gnv1 was found in strain AT10. hyl-2(+):CATCAT: aagcgcagtgatttctggcaaatgcttgttcatcattttatcaccctcgcacttattgg tgtttca; hyl-2(gnv1): CAATAT: aagcgcagtgatttctggcaaatgcttgttcaatattttatcaccctcgcacttattgg tgtttca. Anoxia sensitive. Heat-shock (36 deg Celcius) sensitive.
Proper citation: RRID:WB-STRAIN:WBStrain00022202 Copy
http://www.wormbase.org/db/get?name=WBStrain00022281
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Synonyms: unc-119(ed3) III; axIs1564.
Alternate IDs: WB-STRAIN:JH2163, CGC_JH2163
Notes: axIs1564 [pie-1p::GFP::fog-2 ORF::fog-2 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.|"Made_by: Chris Meritt"
Proper citation: RRID:WB-STRAIN:WBStrain00022281 Copy
http://www.wormbase.org/db/get?name=WBStrain00022280
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Synonyms: unc-119(ed3) III; axIs1563.
Alternate IDs: WB-STRAIN:JH2162, CGC_JH2162
Notes: axIs1563 [pie-1p::GFP::cep-1 ORF::cep-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.|"Made_by: Chris Meritt"
Proper citation: RRID:WB-STRAIN:WBStrain00022280 Copy
http://www.wormbase.org/db/get?name=WBStrain00022273
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Synonyms: unc-119(ed3) III; axIs1720.
Alternate IDs: WB-STRAIN:JH2107, CGC_JH2107
Notes: axIs1720 [pie-1p::GFP::pgl-1 ORF::pgl-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.|"Made_by: Chris Meritt"
Proper citation: RRID:WB-STRAIN:WBStrain00022273 Copy
http://www.wormbase.org/db/get?name=WBStrain00022226
Source Database: WormBase (WB)
Affected Genes: WBGene00000232(avr-14)|WBGene00000233(avr-15)
Genomic Alteration: WBGene00000232(avr-14), WBGene00000233(avr-15)
Availability: available
Synonyms: avr-14(ad1302) I; avr-15(ad1051) V.
Alternate IDs: WB-STRAIN:JD740, CGC_JD740
Notes: Modest ivermectin resistance. Mild feeding defect. Lacks M3 neurotransmission. Reference: Dent JA, et al. Proc Natl Acad Sci U S A. 2000 Mar 14;97(6):2674-9.
Proper citation: RRID:WB-STRAIN:WBStrain00022226 Copy
http://www.wormbase.org/db/get?name=WBStrain00022221
Source Database: WormBase (WB)
Affected Genes: WBGene00001517(gar-1)|WBGene00001519(gar-3)
Genomic Alteration: WBGene00001517(gar-1), WBGene00001519(gar-3)
Availability: available
Synonyms: gar-3(lg1201) V; gar-1(ad1676) X.
Alternate IDs: WB-STRAIN:JD255, CGC_JD255
Notes: Pharyngeal pumping anomalies. Arecoline resistance. Locomotion variant. Reference: Steger KA & Avery L. Genetics. 2004 Jun;167(2):633-43.
Proper citation: RRID:WB-STRAIN:WBStrain00022221 Copy
http://www.wormbase.org/db/get?name=WBStrain00022224
Source Database: WormBase (WB)
Affected Genes: WBGene00000233(avr-15)|WBGene00001591(glc-1)
Genomic Alteration: WBGene00000233(avr-15), WBGene00001591(glc-1)
Availability: available
Synonyms: avr-15(ad1051) glc-1(pk54) V.
Alternate IDs: WB-STRAIN:JD600, CGC_JD600
Notes: Slow pumping. This strain is a replacement for the strain DA1370 whose genotype is actually avr-15(vu227) glc-1(pk54) V. Reference: Dent et al., 2000, Proc. Nat. Acad. Sci. 97(6): 2674-2679.
Proper citation: RRID:WB-STRAIN:WBStrain00022224 Copy
http://www.wormbase.org/db/get?name=WBStrain00022216
Source Database: WormBase (WB)
Affected Genes: WBGene00000367(cca-1)
Genomic Alteration: WBGene00000367(cca-1)
Availability: available
Source References: PMID:37624669
Synonyms: cca-1(ad1650) X.
Alternate IDs: WB-STRAIN:JD21, CGC_JD21
Notes: Mutagen:UV/TMP|"Slow pharyngeal pumping. Abnormal pharyngeal muscle depolarization."|"Supplementary_genotype"
Proper citation: RRID:WB-STRAIN:WBStrain00022216 Copy
http://www.wormbase.org/db/get?name=WBStrain00022218
Source Database: WormBase (WB)
Affected Genes: WBGene00000233(avr-15)
Genomic Alteration: WBGene00000233(avr-15)
Availability: available
Source References: PMID:31220273
Synonyms: avr-15(ad1051) V.
Alternate IDs: WB-STRAIN:JD105, CGC_JD105
Notes: Reference WBPaper00056919 added based on published strain data identified by Textpresso literature search.|"Starved; feeding defective; lacks M3 neurotransmission. From DA1051. DA1051 has bor-1 in the background. bor-1 has been crossed out in JD105."
Proper citation: RRID:WB-STRAIN:WBStrain00022218 Copy
http://www.wormbase.org/db/get?name=WBStrain00022217
Source Database: WormBase (WB)
Affected Genes: WBGene00001594(glc-4)
Genomic Alteration: WBGene00001594(glc-4)
Availability: available
Synonyms: glc-4(ok212) II.
Alternate IDs: WB-STRAIN:JD31, CGC_JD31
Notes: C27H5.8. No obvious phenotype. URL: URL: www.celeganskoconsortium.omrf.org.|"Mutagen:UV/TMP"
Proper citation: RRID:WB-STRAIN:WBStrain00022217 Copy
http://www.wormbase.org/db/get?name=WBStrain00022295
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Synonyms: unc-119(ed3) III; axIs1640.
Alternate IDs: WB-STRAIN:JH2252, CGC_JH2252
Notes: axIs1640 [pie-1p::GFP::histone H2B::glp-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.|"Made_by: Chris Meritt"
Proper citation: RRID:WB-STRAIN:WBStrain00022295 Copy
http://www.wormbase.org/db/get?name=WBStrain00022298
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Synonyms: unc-119(ed3) III; axIs1654.
Alternate IDs: WB-STRAIN:JH2270, CGC_JH2270
Notes: axIs1654 [pie-1p::GFP::histone H2B::fbf-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.|"Made_by: Chris Meritt"
Proper citation: RRID:WB-STRAIN:WBStrain00022298 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
Welcome to the Neuroscience Information Framework Project, designed to serve the biomedical research community. NIF maintains the largest searchable collection of neuroscience data, the largest catalog of biomedical resources, and the largest ontology for neuroscience on the web. We welcome all feedback and suggestions and are actively looking for resource providers to make their resources accessible through NIF. Learn about the tools available to help you share your data and discover a dynamic inventory of Web-based neuroscience resources.
