Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 16 showing 301 ~ 320 out of 147,236 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:WB-STRAIN:WBStrain00037573

http://www.wormbase.org/db/get?name=WBStrain00037573

Source Database: WormBase (WB)
Affected Genes: WBGene00016557(ceh-84)
Genomic Alteration: WBGene00016557(ceh-84)
Availability: available
Source References: EMPTY
Synonyms: C40D2.4(gk1276) II.
Alternate IDs: WB-STRAIN:VC2858, CGC_VC2858
Notes: C40D2.4. External left primer: CATACCCAAAGGTCTGGTGG. External right primer: GCACAACCTGTGCATGTAGG. Internal left primer: CCACAGACCCGCTATTAAGG. Internal right primer: TTCCCAACACTTCAACGTCA. Internal WT amplicon: 1685 bp. Deletion size: 518 bp. Deletion left flank: TCTCCTCAAATGCTGAAAGTGAATAAAGAA. Deletion right flank: CAAAAAATATTTTTCAAAAGATAACATAAA. Insertion Sequence: AGGTGATCTAC.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037573 Copy   


  • RRID:WB-STRAIN:WBStrain00037571

http://www.wormbase.org/db/get?name=WBStrain00037571

Source Database: WormBase (WB)
Affected Genes: WBGene00019275(rpac-40)
Genomic Alteration: WBGene00019275(rpac-40)
Availability: available
Source References: EMPTY
Synonyms: H43I07.2(ok3654) V/nT1 [qIs51] (IV;V).
Alternate IDs: WB-STRAIN:VC2854, CGC_VC2854
Notes: H43I07.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3654 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AGACCTACGACGAATGCACC. External right primer: GGCAATTAACCGAAATCGAA. Internal left primer: AAATCCAAGTGGCAATGGTC. Internal right primer: GCAAATTGCCGAAAAAGAAA. Internal WT amplicon: 1310 bp. Deletion size: 688 bp. Deletion left flank: TTCTGCCGCTTCGTGTGGATCCACGTGGAT. Deletion right flank: ACATCTACCTATATTCAGTATATTTAGACT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037571 Copy   


  • RRID:WB-STRAIN:WBStrain00037574

http://www.wormbase.org/db/get?name=WBStrain00037574

Source Database: WormBase (WB)
Affected Genes: WBGene00011169(R09D1.13)
Genomic Alteration: WBGene00011169(R09D1.13)
Availability: available
Source References: EMPTY
Synonyms: R09D1.13(gk3177) II.
Alternate IDs: WB-STRAIN:VC2859, CGC_VC2859
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain is homozygous for a deletion (gk3177) in R09D1.13, detectable by PCR using the following primers. External left primer: GCAATCGGGATGTTCTGAAT. External right primer: TGTTGGAGAAACTGTGCGAG. Internal left primer: ACAACGAAACATCGTCGGAT. Internal right primer: ATAAATATGGATGCCGCCAA. Internal WT amplicon: 2530 bp. Deletion size: approximately 1400 bp. Validation: gk3177 passed by CGH. Left deleted probe: AGGATCAATTTCGACTGGAATGTTGCCTATACTAATATTATCTCGAATGC. Right deleted probe: AATTAATATAACTAGATCCATTGCCATTTTCGGTTTGGCTGGAACATATA."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037574 Copy   


  • RRID:WB-STRAIN:WBStrain00037575

http://www.wormbase.org/db/get?name=WBStrain00037575

Source Database: WormBase (WB)
Affected Genes: WBGene00010719(K09E4.1)
Genomic Alteration: WBGene00010719(K09E4.1)
Availability: available
Source References: EMPTY
Synonyms: K09E4.1(gk1223) II.
Alternate IDs: WB-STRAIN:VC2860, CGC_VC2860
Notes: K09E4.1. Identified by PCR, validated by CGH. External left primer: TCGGCAAATGTGGTTTTGTA. External right primer: CGAGTTCTCTTCCTCAACCG. Internal left primer: ACACAATGGAGCAGCATCAG. Internal right primer: GGCAATCTTGTGGAACACCT. Internal WT amplicon: 1905 bp. Deletion size: 753 bp. Deletion left flank: CAAATTTTTTTGCCGATTTGCCGGAAATTT. Deletion right flank: GCGATGCGGAACAAGTTCACGCTTGGGACG.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037575 Copy   


  • RRID:WB-STRAIN:WBStrain00037578

http://www.wormbase.org/db/get?name=WBStrain00037578

Source Database: WormBase (WB)
Affected Genes: WBGene00013543(Y75B8A.6)
Genomic Alteration: WBGene00013543(Y75B8A.6)
Availability: available
Source References: EMPTY
Synonyms: Y75B8A.6(ok2294) III.
Alternate IDs: WB-STRAIN:VC2864, CGC_VC2864
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y75B8A.6. External left primer: ACGGATCCCTGAACAGAATG. External right primer: TATATTCACGGGGTTCTGGC. Internal left primer: TTGCTGGAGAGAAAAACGGT. Internal right primer: GGAAACCAGAAATCCGTGAA. Internal WT amplicon: 3060 bp. Deletion size: 903 bp. Deletion left flank: ATACGAAAAAATTCAAAAATTCAAAAAGGA. Deletion right flank: TATATTGAACTCGTTTCACATCAAAATGCA."

Proper citation: RRID:WB-STRAIN:WBStrain00037578 Copy   


  • RRID:WB-STRAIN:WBStrain00037579

http://www.wormbase.org/db/get?name=WBStrain00037579

Source Database: WormBase (WB)
Affected Genes: WBGene00010983(mocs-1)
Genomic Alteration: WBGene00010983(mocs-1)
Availability: available
Source References: EMPTY
Synonyms: R03A10.3(ok3439) X.
Alternate IDs: WB-STRAIN:VC2873, CGC_VC2873
Notes: R03A10.3. External left primer: TGCTGGAGTAGAGCGGGTAT. External right primer: GCAGAGAGCCTGAAAATTGC. Internal left primer: CCTTGTGGAAGGCCTTGTT. Internal right primer: GCACAGCCCTGATTCCTACT. Internal WT amplicon: 1181 bp. Deletion size: 621 bp. Deletion left flank: CAGTTTTTTTCCGTTTCACTTACCACATCG. Deletion right flank: CCCAACTACAGAATGATGCGAATCGTAGAG.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037579 Copy   


  • RRID:WB-STRAIN:WBStrain00037580

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00037580

Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00009701(egg-3)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00009701(egg-3)
Availability: available
Source References: EMPTY
Synonyms: egg-3(ok3651)/mIn1 [mIs14 dpy-10(e128)] II.
Alternate IDs: WB-STRAIN:VC2876, CGC_VC2876
Notes: F44F4.2. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3651 homozygotes (sterile giving unfertilized eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AATAAGCCGGTGTGATACGG. External right primer: TCGATGTCTGATTGCAGCTC. Internal left primer: ATCGATTTGAAGCGAAGGC. Internal right primer: GTCAATTGAATCCGGAGCAT. Internal WT amplicon: 1211 bp. Deletion size: 555 bp. Deletion left flank: ATGGAATGATCCAAAACGAAGAGATTCATT. Deletion right flank: ACTGAACTTCCCCGGCTCAACAAGCAGTGA. Insertion Sequence: TCTCGAAGAGATTCATTCTC.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037580 Copy   


  • RRID:WB-STRAIN:WBStrain00037583

http://www.wormbase.org/db/get?name=WBStrain00037583

Source Database: WormBase (WB)
Affected Genes: WBGene00006829(unc-101)|WBGene00009305(metl-17)
Genomic Alteration: WBGene00006829(unc-101), WBGene00009305(metl-17)
Availability: available
Source References: EMPTY
Synonyms: F32A7.4(ok3586)/hIn1 [unc-101(sy241)] I.
Alternate IDs: WB-STRAIN:VC2896, CGC_VC2896
Notes: F32A7.4. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok3586 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: ATTGTGCGTTATTTCGGAGC. External right primer: CTTTCATCCGTCATTGCTCA. Internal left primer: GACTATTTCTTCGACATTTTATTGC. Internal right primer: GGGTAGATTTTGAAAAAGAAACG. Internal WT amplicon: 1238 bp. Deletion size: 539 bp. Deletion left flank: ATTTGAGGTAAACGAAAAAATAATATAAAA. Deletion right flank: GGCAAGATTAGCCCCAAACTATGCAGAAAT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037583 Copy   


  • RRID:WB-STRAIN:WBStrain00037584

http://www.wormbase.org/db/get?name=WBStrain00037584

Source Database: WormBase (WB)
Affected Genes: WBGene00006829(unc-101)|WBGene00013597(gpi-1)
Genomic Alteration: WBGene00006829(unc-101), WBGene00013597(gpi-1)
Availability: available
Source References: EMPTY
Synonyms: gpi-1(ok3599)/hIn1 [unc-101(sy241)] I.
Alternate IDs: WB-STRAIN:VC2897, CGC_VC2897
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"Y87G2A.8. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok3599 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TGTCTGAGCCTCAACCAAAA. External right primer: CTCTCACTCAAAATGCGGGT. Internal left primer: CAGAATTTTGAGAAAATCCAACG. Internal right primer: AGTTTGTAGCCCCTCAGCCT. Internal WT amplicon: 1205 bp. Deletion size: 621 bp. Deletion left flank: ACCAAATCGGACCGAATGTGCACTTCGTGT. Deletion right flank: ATCAGTTGATTCATCAGGGTACTCGACTGA."

Proper citation: RRID:WB-STRAIN:WBStrain00037584 Copy   


  • RRID:WB-STRAIN:WBStrain00037547

http://www.wormbase.org/db/get?name=WBStrain00037547

Source Database: WormBase (WB)
Affected Genes: WBGene00018123(F36H12.9)
Genomic Alteration: WBGene00018123(F36H12.9)
Availability: available
Source References: EMPTY
Synonyms: F36H12.9(gk1123) IV.
Alternate IDs: WB-STRAIN:VC2795, CGC_VC2795
Notes: F36H12.9. Identified by PCR, validated by CGH. External left primer: TGTTGTGGAAGTGCAAGAGG. External right primer: CGTATCGGTTAGTCGGCATT. Internal left primer: GCCTCAGCGATATGGAGAAG. Internal right primer: AGAAATCCTTTGTCGATGCG. Internal WT amplicon: 1008 bp. Deletion size: 761 bp. Deletion left flank: TACTCCGCCTCAGCGATATGGAGAAGTTTG. Deletion right flank: ATATATTGTTTTCAGTACTTGGATACTCTT.|"Made_by: Vancouver KO Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037547 Copy   


  • RRID:WB-STRAIN:WBStrain00037546

http://www.wormbase.org/db/get?name=WBStrain00037546

Source Database: WormBase (WB)
Affected Genes: WBGene00020388(T10B5.2)
Genomic Alteration: WBGene00020388(T10B5.2)
Availability: available
Source References: EMPTY
Synonyms: T10B5.2(gk1153) V.
Alternate IDs: WB-STRAIN:VC2793, CGC_VC2793
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"T10B5.2. External left primer: CTCGGTTTGTACCATGGCTT. External right primer: AATTTTGCGTATTGCGAACC. Internal left primer: GATCTTCCTCATCGTGCCAT. Internal right primer: AGGACATCCGGGAGAGACTT. Internal WT amplicon: 2414 bp. Deletion size: 851 bp. Deletion left flank: AAATGATAGAAGGTCTGCTGGTACTGTGTT. Deletion right flank: GTCCCTCCATCCATCTTCGATATTTTTGGT. Insertion Sequence: TTGTTTGTGT."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037546 Copy   


  • RRID:WB-STRAIN:WBStrain00037550

http://www.wormbase.org/db/get?name=WBStrain00037550

Source Database: WormBase (WB)
Affected Genes: WBGene00005724(srv-13)|WBGene00010772(K11D9.3)|WBGene00011327(hlh-34)
Genomic Alteration: WBGene00005724(srv-13), WBGene00010772(K11D9.3), WBGene00011327(hlh-34)
Availability: available
Source References: EMPTY
Synonyms: K11D9.3(gk3223) III; srv-13(gk3224) IV; hlh-34(gk1211) V.
Alternate IDs: WB-STRAIN:VC2802, CGC_VC2802
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain is homozygous for a deletion (gk1211) in T01D3.2, detectable by PCR using the following primers. External left primer: GTGAAGCCGAAGGATCATGT. External right primer: CGTCTTTGCTTTCTTTTCCG. Internal left primer: GAAGAACTTTGCATCGAGGG. Internal right primer: TGTCCAACAATTTCCAACGA. Internal WT amplicon: 1737 bp. Deletion size: 301 bp. Deletion left flank: TTAAAAAACAGAAAAAAAATTAAAAATATA. Deletion right flank: CATCTCCGCGCCTGTCCAGTATCACAAAGA. Validation: gk1211 passed by CGH. Other deletions (gk3223, gk3224) identified by CGH."|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037550 Copy   


  • RRID:WB-STRAIN:WBStrain00037554

http://www.wormbase.org/db/get?name=WBStrain00037554

Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00008860(romo-1)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00008860(romo-1)
Availability: available
Source References: EMPTY
Synonyms: F15D4.3(ok3521)/mT1 II; +/mT1 [dpy-10(e128)] III.
Alternate IDs: WB-STRAIN:VC2819, CGC_VC2819
Notes: F15D4.3. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3521 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGATTCGGCAAGAGAGGTCA. External right primer: AAAGTTTTGCTCCTGTGCGT. Internal left primer: TAATAATCCCTTGAGCCCCC. Internal right primer: AACGATTTCTTTCACAAAGTGGA. Internal WT amplicon: 1187 bp. Deletion size: 378 bp. Deletion left flank: CTTCTCTTCTCCCTGTGTGTACCAGTGTAC. Deletion right flank: TCGAATCTGGAAATTTTGAAAATAAATTAG.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037554 Copy   


  • RRID:WB-STRAIN:WBStrain00037552

http://www.wormbase.org/db/get?name=WBStrain00037552

Source Database: WormBase (WB)
Affected Genes: WBGene00013727(Y111B2A.1)
Genomic Alteration: WBGene00013727(Y111B2A.1)
Availability: available
Source References: EMPTY
Synonyms: Y111B2A.1(gk1164) III.
Alternate IDs: WB-STRAIN:VC2805, CGC_VC2805
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y111B2A.1. External left primer: GAAGCTCGAAGAGTGGGATG. External right primer: AGTGTATGCAGCGTGTTTGC. Internal left primer: CCTCTTTGAATTACCGCCAA. Internal right primer: TTTCAGATGAAACGTGCGAG. Internal WT amplicon: 2262 bp. Deletion size: 614 bp. Deletion left flank: TTAATTAATTTCACTGATTTACGCCTGTAA. Deletion right flank: AAAATTGTTTCCAGCCGCTGCGACAATGAT."

Proper citation: RRID:WB-STRAIN:WBStrain00037552 Copy   


  • RRID:WB-STRAIN:WBStrain00037558

http://www.wormbase.org/db/get?name=WBStrain00037558

Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00003133(apc-1)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00003133(apc-1)
Availability: available
Source References: PMID:38302462
Synonyms: C09H10.7(ok2466)/mIn1 [mIs14 dpy-10(e128)] II.
Alternate IDs: WB-STRAIN:VC2826, CGC_VC2826
Notes: C009H10.7. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2466 homozygotes (sterile adult, no eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CAAATTTCCAGGTTCGTCGT. External right primer: TTCCTGTTCGAAACGAGGTT. Internal left primer: GTGGATGCTCCAACTGACAA. Internal right primer: TGACGATTTGAATGTCTGATACAA. Internal WT amplicon: 1330 bp. Deletion size: 550 bp. Deletion left flank: TATACTTGTATGAGTGAAGAATTTGATGAT. Deletion right flank: TCATCCAGCGAACAAACCTTCCACCATCAC. Insertion Sequence: CCATCGGA.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037558 Copy   


  • RRID:WB-STRAIN:WBStrain00037559

http://www.wormbase.org/db/get?name=WBStrain00037559

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00013580(Y79H2A.3)
Genomic Alteration: WBGene00000254(bli-4), WBGene00013580(Y79H2A.3)
Availability: available
Source References: PMID:38302462
Synonyms: Y79H2A.3(gk1219) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2828, CGC_VC2828
Notes: Mutagen:UV/TMP|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y79H2A.3. Maternal-effect lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk1219 homozygotes (Mel; F2 homozygotes arrest as early larvae). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAACATGCTTCTTCCATGCC. External right primer: AGCGAAATTTGGACTAGCGA. Internal left primer: TTCATTGCGTGATATTCCGA. Internal right primer: TCTGGACGTGTGCTACTTGC. Internal WT amplicon: 1396 bp. Deletion size: 1073 bp. Deletion left flank: GTTCATCACCAGCATTAATGAGATATCGAT. Deletion right flank: TAGCTAATTTTGAACCGCCATAAAACTTTT."

Proper citation: RRID:WB-STRAIN:WBStrain00037559 Copy   


  • RRID:WB-STRAIN:WBStrain00037556

http://www.wormbase.org/db/get?name=WBStrain00037556

Source Database: WormBase (WB)
Affected Genes: WBGene00000254(bli-4)|WBGene00010419(atp-1)
Genomic Alteration: WBGene00000254(bli-4), WBGene00010419(atp-1)
Availability: available
Source References: PMID:38302462
Synonyms: H28O16.1(ok2203) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III).
Alternate IDs: WB-STRAIN:VC2824, CGC_VC2824
Notes: H28O16.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2203 homozygotes (probable embryonic arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAATCCTGACAGCTCGTTGG. External right primer: TTCGAAACAGGAGCTTTGCT. Internal left primer: TGTTGTCCAAACGCATTGTT. Internal right primer: ATTCTCGCAGAACACACACG. Internal WT amplicon: 2289 bp. Deletion size: 1121 bp. Deletion left flank: GACGTGTTGTTGACGCCCTCGGAAACCCAA. Deletion right flank: ATACCTCGACAAGGTCGACCCATCCGCCAT. Insertion Sequence: A.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037556 Copy   


  • RRID:WB-STRAIN:WBStrain00037562

http://www.wormbase.org/db/get?name=WBStrain00037562

Source Database: WormBase (WB)
Affected Genes: WBGene00001072(dpy-10)|WBGene00022721(ugtp-1)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00022721(ugtp-1)
Availability: available
Source References: EMPTY
Synonyms: +/mT1 II; ugtp-1(ok3492)/mT1 [dpy-10(e128)] III.
Alternate IDs: WB-STRAIN:VC2837, CGC_VC2837
Notes: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.|"ZK370.7. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok3492 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CCAATCCGTTTCTGTCGTCT. External right primer: ATGATGCTCTTTCTCGGTCG. Internal left primer: TTGGCGAGAATTTATGAGCC. Internal right primer: TCGATGGATGGCAATTACAC. Internal WT amplicon: 1168 bp. Deletion size: 505 bp. Deletion left flank: TTAAGTTTATACAATTAAAGCTTTTGGCTA. Deletion right flank: TTTTTCAAACGATTTGAAAAAAAAACCCTA."

Proper citation: RRID:WB-STRAIN:WBStrain00037562 Copy   


  • RRID:WB-STRAIN:WBStrain00037560

http://www.wormbase.org/db/get?name=WBStrain00037560

Source Database: WormBase (WB)
Affected Genes: WBGene00003056(lon-2)|WBGene00006757(unc-18)
Genomic Alteration: WBGene00003056(lon-2), WBGene00006757(unc-18)
Availability: available
Source References: EMPTY
Synonyms: +/szT1 [lon-2(e678)] I; unc-18(ok3477)/szT1 X.
Alternate IDs: WB-STRAIN:VC2835, CGC_VC2835
Notes: F27D9.1. Homozygous viable deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok3477 homozygotes (Unc). Pick WT and check for correct segregation of progeny to maintain. External left primer: GGTGGTCTGACATCGAACCT. External right primer: GGGGCTCTGAAAATGAAACA. Internal left primer: GAATTGCTGAACAAATCGCA. Internal right primer: GGGTTGAAATGAGCAATCATC. Internal WT amplicon: 1331 bp. Deletion size: 371 bp. Deletion left flank: TTACTCTTCAAGCAATGTGCTACGACCTTT. Deletion right flank: CAGTATCAACAAGGAGTTGACAAGTTGTGT. Insertion Sequence: AGACCTT.|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00037560 Copy   


  • RRID:WB-STRAIN:WBStrain00037529

http://www.wormbase.org/db/get?name=WBStrain00037529

Source Database: WormBase (WB)
Affected Genes: WBGene00013994(ZK524.4)
Genomic Alteration: WBGene00013994(ZK524.4)
Availability: available
Source References: EMPTY
Synonyms: ZK524.4(gk1212) I.
Alternate IDs: WB-STRAIN:VC2760, CGC_VC2760
Notes: Made_by: Vancouver KO Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK524.4. Identified by PCR, validated by CGH. External left primer: GAAGTACCTGCTGCTTTGCC. External right primer: TATATGCAACTGCGCTCCAG. Internal left primer: GCTATTGCTCCAGCAACCAT. Internal right primer: TATGTCAAATGCGCCTGAAA. Internal WT amplicon: 1629 bp. Deletion size: 823 bp. Deletion left flank: AGCATATACAAAATAACACCTAATGACCAT. Deletion right flank: CCCTGATGTGCAACGATGATTTTCGGCGGA. Insertion Sequence: GTTCAGCATGGTCAAATATAC."

Proper citation: RRID:WB-STRAIN:WBStrain00037529 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X