Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00029004
Source Database: WormBase (WB)
Affected Genes: WBGene00001680(gpb-2)
Genomic Alteration: WBGene00001680(gpb-2)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:NL2784
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00029004 Copy
http://www.wormbase.org/db/get?name=WBStrain00029085
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; cdIs36.
Alternate IDs: WB-STRAIN:NP738, CGC_NP738
Notes: cdIs36 [pcc1::C31E10.7::GFP + myo-2p::GFP + unc-119(+)]. Ballistic transformation. C31E10.7::GFP (smooth ER marker) expressed in front coelomocyte promoter.|"cdIs36 [pcc1::C31E10.7::GFP + unc-119(+) + myo-2::GFP]. Ballistic transformation. C31E10.7::GFP (smooth ER marker) expressed in front coelomocyte promoter."
Proper citation: RRID:WB-STRAIN:WBStrain00029085 Copy
http://www.wormbase.org/db/get?name=WBStrain00029086
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; cdIs39 X.
Alternate IDs: WB-STRAIN:NP744, CGC_NP744
Notes: cdIs39 [pcc1::GFP::rme-1(271alpha1) + myo-2::GFP + unc-119(+)].|"cdIs39 [pcc1::GFP::rme-1(271alpha1) + myo-2p::GFP + unc-119(+)]."
Proper citation: RRID:WB-STRAIN:WBStrain00029086 Copy
http://www.wormbase.org/db/get?name=WBStrain00029088
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: PMID:39418305
Synonyms: unc-119(ed3) III; cdIs54.
Alternate IDs: WB-STRAIN:NP822, CGC_NP822
Notes: cdIs54 [pcc1::MANS::GFP + myo-2p::GFP + unc-119(+)]. Ballistic transformation. Mannosidasell::GFP (Golgi marker) expressed in front coelomocyte promoter.|"cdIs54 [pcc1::MANS::GFP + unc-119(+) + myo-2::GFP]. Ballistic transformation. Mannosidasell::GFP (Golgi marker) expressed in front coelomocyte promoter."
Proper citation: RRID:WB-STRAIN:WBStrain00029088 Copy
http://www.wormbase.org/db/get?name=WBStrain00029081
Source Database: WormBase (WB)
Affected Genes: WBGene00006654(ttx-3)
Genomic Alteration: WBGene00006654(ttx-3)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:NP97
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00029081 Copy
http://www.wormbase.org/db/get?name=WBStrain00029084
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; cdIs29.
Alternate IDs: WB-STRAIN:NP705, CGC_NP705
Notes: cdIs29 [pcc1::GFP::TRAM + unc-119p::ttx-3::GFP].
Proper citation: RRID:WB-STRAIN:WBStrain00029084 Copy
http://www.wormbase.org/db/get?name=WBStrain00029078
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00002285(let-7)|WBGene00003001(lin-12)|WBGene00006743(unc-3)
Genomic Alteration: WBGene00001864(him-5), WBGene00002285(let-7), WBGene00003001(lin-12), WBGene00006743(unc-3)
Availability: available
Source References: EMPTY
Synonyms: lin-12(n137n460) III; him-5(e1467) V; unc-3(e151) let-7(mn112) X.
Alternate IDs: WB-STRAIN:NOA2, CGC_NOA2
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00029078 Copy
http://www.wormbase.org/db/get?name=WBStrain00029074
Source Database: WormBase (WB)
Affected Genes: WBGene00004121(ptrn-1)
Genomic Alteration: WBGene00004121(ptrn-1)
Availability: available
Source References: EMPTY
Synonyms: jsIs973 III; ptrn-1(js1286) X.
Alternate IDs: WB-STRAIN:NM4397, CGC_NM4397
Notes: jsIs973 [mec-7p::mRFP + unc-119(+)] III. Strong RFP cytosolic marker for mechanosensory neurons (Zheng et al. 2011, PMID 21115607).|"Made_by: Jana Marcette"
Proper citation: RRID:WB-STRAIN:WBStrain00029074 Copy
http://www.wormbase.org/db/get?name=WBStrain00029075
Source Database: WormBase (WB)
Affected Genes: WBGene00004121(ptrn-1)
Genomic Alteration: WBGene00004121(ptrn-1)
Availability: available
Source References: EMPTY
Synonyms: jsIs973 III; oxIs12 ptrn-1(tm5597) X.
Alternate IDs: WB-STRAIN:NM4422, CGC_NM4422
Notes: jsIs973[mec-7p::mRFP + unc-119(+)] III. oxIs12 [unc-47p::GFP + lin-15(+)] X. oxIs12 integration maps at +2.0 on X. Strong RFP cytosolic marker for mechanosensory neurons (Zheng et al. 2011, PMID 21115607). Expression of GFP in all GABAergic neurons.|"Mutagen:TMP+UV"|"Mutagen:TMP/UV"
Proper citation: RRID:WB-STRAIN:WBStrain00029075 Copy
http://www.wormbase.org/db/get?name=WBStrain00029077
Source Database: WormBase (WB)
Affected Genes: WBGene00001864(him-5)|WBGene00002285(let-7)|WBGene00003001(lin-12)
Genomic Alteration: WBGene00001864(him-5), WBGene00002285(let-7), WBGene00003001(lin-12)
Availability: available
Source References: EMPTY
Synonyms: lin-12(n137n460) III; him-5(e1467) V; let-7(n2853) X.
Alternate IDs: WB-STRAIN:NOA1, CGC_NOA1
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00029077 Copy
http://www.wormbase.org/db/get?name=WBStrain00029070
Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: jsIs423.
Alternate IDs: WB-STRAIN:NM3159, CGC_NM3159
Notes: jsIs423 [rbf-1::GFP + rol-6(su1006)]. Rollers. Maintain under normal conditions. Reference: Mahoney TR., et al. Mol Biol Cell. 2006 Jun;17(6):2617-25.
Proper citation: RRID:WB-STRAIN:WBStrain00029070 Copy
http://www.wormbase.org/db/get?name=WBStrain00029071
Source Database: WormBase (WB)
Affected Genes: WBGene00006454(aex-4)
Genomic Alteration: WBGene00006454(aex-4)
Availability: available
Source References: EMPTY
Synonyms: aex-4(n2415) X; jsEx1028.
Alternate IDs: WB-STRAIN:NM3458, CGC_NM3458
Notes: jsEx1028 [aex-4p::GFP::aex + myo-2p::GFP + pBS]. Pick GFP+ to maintain. Reference: Mahoney TR, et al. Proc Natl Acad Sci U S A. 2008 Oct 21;105(42):16350-5.
Proper citation: RRID:WB-STRAIN:WBStrain00029071 Copy
http://www.wormbase.org/db/get?name=WBStrain00029023
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: PMID:21938067, PMID:31704915
Synonyms: unc-119(ed3) III; pkIs1642.
Alternate IDs: WB-STRAIN:NL3909, CGC_NL3909
Notes: pkIs1642[unc-119(+) + R11A8.5(+) + sir-2.1(+)]. Non-Unc strain.|"Reference WBPaper00058832 added based on published strain data identified by Textpresso literature search."
Proper citation: RRID:WB-STRAIN:WBStrain00029023 Copy
http://www.wormbase.org/db/get?name=WBStrain00029026
Source Database: WormBase (WB)
Affected Genes: WBGene00004178(prg-1)
Genomic Alteration: WBGene00004178(prg-1)
Availability: available
Source References: EMPTY
Synonyms: prg-1 (pk2298) I.
Alternate IDs: WB-STRAIN:NL4110, CGC_NL4110
Notes: Superficially wildtype.
Proper citation: RRID:WB-STRAIN:WBStrain00029026 Copy
http://www.wormbase.org/db/get?name=WBStrain00029020
Source Database: WormBase (WB)
Affected Genes: WBGene00001088(dpy-30)
Genomic Alteration: WBGene00001088(dpy-30)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:NL3848
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00029020 Copy
http://www.wormbase.org/db/get?name=WBStrain00029017
Source Database: WormBase (WB)
Affected Genes: WBGene00001332(eri-1)|WBGene00004027(pie-1)
Genomic Alteration: WBGene00001332(eri-1), WBGene00004027(pie-1)
Availability: available
Source References: EMPTY
Synonyms: pkIs32 III; eri-1(mg366) IV.
Alternate IDs: WB-STRAIN:NL3630, CGC_NL3630
Notes: pkIs32[pie-1::GFP::H2B]. RNAi hypersensitive.
Proper citation: RRID:WB-STRAIN:WBStrain00029017 Copy
http://www.wormbase.org/db/get?name=WBStrain00029018
Source Database: WormBase (WB)
Affected Genes: WBGene00006759(unc-22)
Genomic Alteration: WBGene00006759(unc-22)
Availability: available
Source References: PMID:37078421
Synonyms: unc-22(st136) IV.
Alternate IDs: WB-STRAIN:NL3643, CGC_NL3643
Notes: Alt Genotype: unc-22(st136)|"Contains Construct Originally made by Dr. Nadine Vastenhouw."|"The unc-22(st136) allele harbors a transposon insertion. Animals have a twitcher phenotype."|"Twitcher Unc. Flanking sequence: agattgacgagatccataaggaaggatgta cattgaactggaagcctccaactgataacg.Twitcher Unc."
Proper citation: RRID:WB-STRAIN:WBStrain00029018 Copy
http://www.wormbase.org/db/get?name=WBStrain00029014
Source Database: WormBase (WB)
Affected Genes: WBGene00002016(hsp-16.2)
Genomic Alteration: WBGene00002016(hsp-16.2)
Availability: available
Source References: EMPTY
Synonyms: pkIs1605.
Alternate IDs: WB-STRAIN:NL3401, CGC_NL3401
Notes: pkIs1605 [hsp-16.2p::GFP::LacZ + rol-6(su1006)]. Rollers.
Proper citation: RRID:WB-STRAIN:WBStrain00029014 Copy
http://www.wormbase.org/db/get?name=WBStrain00029015
Source Database: WormBase (WB)
Affected Genes: WBGene00004093(ppw-1)
Genomic Alteration: WBGene00004093(ppw-1)
Availability: available
Source References: PMID:31717869, PMID:32943454, PMID:36176234, PMID:37865119
Synonyms: ppw-1(pk1425) I.
Alternate IDs: WB-STRAIN:NL3511, CGC_NL3511
Notes: Mutagen:UV/TMP|"ppw-1 animals are resistant to feeding of ds RNA directed against germline genes. The genomic region that is deleted: nt 2479-3982 of C18E3 (intragenic deletion in C18E3.7). This strain was formerly called NL2557."|"Reference WBPaper00058851 added based on published strain data identified by Textpresso literature search."|"Supplementary_genotype [ppw1(pk1425)"|"WBStrain provided so WBPaper00060343 paper added based on AFP_Strain data."
Proper citation: RRID:WB-STRAIN:WBStrain00029015 Copy
http://www.wormbase.org/db/get?name=WBStrain00029096
Source Database: WormBase (WB)
Affected Genes: WBGene00006843(unc-119)
Genomic Alteration: WBGene00006843(unc-119)
Availability: available
Source References: EMPTY
Synonyms: unc-119(ed3) III; cdIs141.
Alternate IDs: WB-STRAIN:NP1154, CGC_NP1154
Notes: cdIs141[pcc1::mCherry::rab-7 + ttx-3::GFP + unc-119(+)]. Ballistic transformation. mCherry::RAB-7 expressed in front coelomocyte promoter.|"cdIs141[pcc1::mCherry::RAB-7 + unc-119(+) + ttx-3::GFP]. Ballistic transformation. mCherry::RAB-7 expressed in front coelomocyte promoter."
Proper citation: RRID:WB-STRAIN:WBStrain00029096 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within NIF that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.