Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 155 showing 3081 ~ 3100 out of 64,152 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:WB-STRAIN:WBStrain00034113

http://www.wormbase.org/db/get?name=WBStrain00034113

Source Database: WormBase (WB)
Affected Genes: WBGene00000238(bar-1)|WBGene00003510(mxl-2)
Genomic Alteration: WBGene00000238(bar-1), WBGene00003510(mxl-2)
Availability: available
Source References: EMPTY
Synonyms: mxl-2(tm1516) III; bar-1(ga80) X.
Alternate IDs: WB-STRAIN:SM1508, CGC_SM1508
Notes: Most defects are similar to bar-1(ga80) single mutant animals [bar-1(ga80) hermaphrodites are usually Egl and often have a protruding vulva (Pvl), although approx. 40% of animals appear WT on plates. Also slightly Unc. In bar-1(ga80) hermaphrodites any of the six vulval precursor cells (P3.p - P8.p) can sometimes fuse with hyp7 without dividing, and P5.p - P7.p can adopt the tertiary cell fate instead of the primary or secondary fates. In addition, the neuroblast QL and its progeny migrate towards the anterior instead of the posterior, and the cell P12 usually adopts the fate of P11. bar-1(ga80) do mate, but poorly. bar-1 encodes a beta-catenin molecule and the ga80 mutation is predicted to cause an early truncation of the protein.] Increased severity of ray 1 displacement.

Proper citation: RRID:WB-STRAIN:WBStrain00034113 Copy   


  • RRID:WB-STRAIN:WBStrain00034114

http://www.wormbase.org/db/get?name=WBStrain00034114

Source Database: WormBase (WB)
Affected Genes: WBGene00003976(pes-1)
Genomic Alteration: WBGene00003976(pes-1)
Availability: unknown
Source References: EMPTY
Synonyms: EMPTY
Alternate IDs: WB-STRAIN:SM1535
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00034114 Copy   


  • RRID:WB-STRAIN:WBStrain00034116

http://www.wormbase.org/db/get?name=WBStrain00034116

Source Database: WormBase (WB)
Affected Genes: WBGene00000238(bar-1)|WBGene00001864(him-5)|WBGene00004047(plx-1)
Genomic Alteration: WBGene00000238(bar-1), WBGene00001864(him-5), WBGene00004047(plx-1)
Availability: available
Source References: EMPTY
Synonyms: plx-1(nc37) IV; him-5(e1490) V; bar-1(ga80) X.
Alternate IDs: WB-STRAIN:SM1585, CGC_SM1585
Notes: Hermaphrodites are sluggish and exhibit protruding vulva, ruptured vulva, or internally hatched progeny. Males move slower than WT and have disorganized tail rays.

Proper citation: RRID:WB-STRAIN:WBStrain00034116 Copy   


  • RRID:WB-STRAIN:WBStrain00034120

http://www.wormbase.org/db/get?name=WBStrain00034120

Source Database: WormBase (WB)
Availability: available
Source References: EMPTY
Synonyms: cyp-37A1(ssd9) II.
Alternate IDs: WB-STRAIN:SOZ300, CGC_SOZ300
Notes: Made_by: Shaobing O. Zhang|"ssd9 is a Class III supersized lipid droplet mutation. 68bp deletion 5' flanking sequence: cacacatccgtacgtggtgg. 3' flanking sequence: cgacaactgattggttatga References: Li S, et al. G3 (Bethesda). 2016 Aug 9;6(8):2407-19. Li S, et al. Proc Natl Acad Sci U S A. 2017 Aug 15;114(33):8841-8846. cyp-37A1 previously known as drop-1."

Proper citation: RRID:WB-STRAIN:WBStrain00034120 Copy   


  • RRID:WB-STRAIN:WBStrain00034121

http://www.wormbase.org/db/get?name=WBStrain00034121

Source Database: WormBase (WB)
Affected Genes: WBGene00008205(sams-1)
Genomic Alteration: WBGene00008205(sams-1)
Availability: unknown
Source References: EMPTY
Synonyms: sams-1(ssd206) X.
Alternate IDs: WB-STRAIN:SOZ471
Notes: no longer available from the CGC|"sams-1 (a.k.a.- drop-4) Class IV supersized lipid droplet mutant. GCT-->GTT mutation. 5' flanking sequence: agatccaaatgcaaaggttg. 3' flanking sequence: ttgcgagaccgtaacaaaaa References: Li S, et al. G3 (Bethesda). 2016 Aug 9;6(8):2407-19. Li S, et al. Proc Natl Acad Sci U S A. 2017 Aug 15;114(33):8841-8846."

Proper citation: RRID:WB-STRAIN:WBStrain00034121 Copy   


  • RRID:WB-STRAIN:WBStrain00034122

http://www.wormbase.org/db/get?name=WBStrain00034122

Source Database: WormBase (WB)
Affected Genes: WBGene00001262(emb-8)
Genomic Alteration: WBGene00001262(emb-8)
Availability: available
Source References: EMPTY
Synonyms: emb-8(ssd89) III.
Alternate IDs: WB-STRAIN:SOZ511, CGC_SOZ511
Notes: emb-8 (a.k.a.- drop-8) Class III supersized lipid droplet mutation. ssd89 is a GGT-->GAT mutation. 5' flanking sequence: ggtgctcactctgctcgctg. 3' flanking sequence: tggagcaattatattccttt References: Li S, et al. G3 (Bethesda). 2016 Aug 9;6(8):2407-19. Li S, et al. Proc Natl Acad Sci U S A. 2017 Aug 15;114(33):8841-8846.|"Made_by: Shaobing O. Zhang"

Proper citation: RRID:WB-STRAIN:WBStrain00034122 Copy   


  • RRID:WB-STRAIN:WBStrain00034123

http://www.wormbase.org/db/get?name=WBStrain00034123

Source Database: WormBase (WB)
Affected Genes: WBGene00006743(unc-3)|WBGene00006747(unc-7)
Genomic Alteration: WBGene00006743(unc-3), WBGene00006747(unc-7)
Availability: available
Source References: EMPTY
Synonyms: unc-3(e151) unc-7(e139) X.
Alternate IDs: WB-STRAIN:SP14, CGC_SP14
Notes: Made_by:

Proper citation: RRID:WB-STRAIN:WBStrain00034123 Copy   


  • RRID:WB-STRAIN:WBStrain00034124

http://www.wormbase.org/db/get?name=WBStrain00034124

Source Database: WormBase (WB)
Affected Genes: WBGene00006743(unc-3)|WBGene00006749(unc-9)
Genomic Alteration: WBGene00006743(unc-3), WBGene00006749(unc-9)
Availability: available
Source References: EMPTY
Synonyms: unc-9(e101) unc-3(e151) X.
Alternate IDs: WB-STRAIN:SP15, CGC_SP15
Notes: Made_by:

Proper citation: RRID:WB-STRAIN:WBStrain00034124 Copy   


  • RRID:WB-STRAIN:WBStrain00034125

http://www.wormbase.org/db/get?name=WBStrain00034125

Source Database: WormBase (WB)
Affected Genes: WBGene00001063(dpy-1)|WBGene00006768(unc-32)
Genomic Alteration: WBGene00001063(dpy-1), WBGene00006768(unc-32)
Availability: available
Source References: EMPTY
Synonyms: unc-32(e189) dpy-1(e1) III.
Alternate IDs: WB-STRAIN:SP17, CGC_SP17
Notes: DpyUnc.

Proper citation: RRID:WB-STRAIN:WBStrain00034125 Copy   


  • RRID:WB-STRAIN:WBStrain00034126

http://www.wormbase.org/db/get?name=WBStrain00034126

Source Database: WormBase (WB)
Affected Genes: WBGene00001067(dpy-5)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00001067(dpy-5), WBGene00006789(unc-54)
Availability: available
Source References: EMPTY
Synonyms: dpy-5(e61) unc-54(e190) I.
Alternate IDs: WB-STRAIN:SP24, CGC_SP24
Notes: DpyUnc.

Proper citation: RRID:WB-STRAIN:WBStrain00034126 Copy   


  • RRID:WB-STRAIN:WBStrain00034127

http://www.wormbase.org/db/get?name=WBStrain00034127

Source Database: WormBase (WB)
Affected Genes: WBGene00001068(dpy-6)|WBGene00006746(unc-6)
Genomic Alteration: WBGene00001068(dpy-6), WBGene00006746(unc-6)
Availability: available
Source References: EMPTY
Synonyms: unc-6(e78) dpy-6(e14) X.
Alternate IDs: WB-STRAIN:SP64, CGC_SP64
Notes: Dpy. Unc.

Proper citation: RRID:WB-STRAIN:WBStrain00034127 Copy   


  • RRID:WB-STRAIN:WBStrain00034175

http://www.wormbase.org/db/get?name=WBStrain00034175

Source Database: WormBase (WB)
Affected Genes: WBGene00002280(let-2)|WBGene00006743(unc-3)
Genomic Alteration: WBGene00002280(let-2), WBGene00006743(unc-3)
Availability: available
Source References: PMID:574105
Synonyms: mnDp1 (X;V)/+ V; unc-3(e151) let-2(mn131) X.
Alternate IDs: WB-STRAIN:SP250, CGC_SP250
Notes: GROWTH SLOW LETHAL EMBRYONIC ts(TEMPERATURE-SENS) See also CGC 1806.|"Made_by: Meneely P"

Proper citation: RRID:WB-STRAIN:WBStrain00034175 Copy   


  • RRID:WB-STRAIN:WBStrain00034178

http://www.wormbase.org/db/get?name=WBStrain00034178

Source Database: WormBase (WB)
Affected Genes: WBGene00002312(let-37)|WBGene00006743(unc-3)
Genomic Alteration: WBGene00002312(let-37), WBGene00006743(unc-3)
Availability: available
Source References: PMID:574105
Synonyms: mnDp1 (X;V)/+ V; unc-3(e151) let-37(mn138) X.
Alternate IDs: WB-STRAIN:SP257, CGC_SP257
Notes: LETHAL EARLY LARVAL. Maintain by picking WT.|"Made_by: Meneely P"

Proper citation: RRID:WB-STRAIN:WBStrain00034178 Copy   


  • RRID:WB-STRAIN:WBStrain00034179

http://www.wormbase.org/db/get?name=WBStrain00034179

Source Database: WormBase (WB)
Affected Genes: WBGene00002311(let-36)|WBGene00006743(unc-3)
Genomic Alteration: WBGene00002311(let-36), WBGene00006743(unc-3)
Availability: available
Source References: PMID:574105
Synonyms: mnDp1 (X;V)/+ V; unc-3(e151) let-36(mn140) X.
Alternate IDs: WB-STRAIN:SP259, CGC_SP259
Notes: GROWTH SLOW. MALE-RESCUED. STERILE. Maintain by picking WT.|"Made_by: Meneely P"

Proper citation: RRID:WB-STRAIN:WBStrain00034179 Copy   


  • RRID:WB-STRAIN:WBStrain00034182

http://www.wormbase.org/db/get?name=WBStrain00034182

Source Database: WormBase (WB)
Availability: available
Source References: PMID:574105
Synonyms: mnDp1(X;V)/+ V; mnDf1 X.
Alternate IDs: WB-STRAIN:SP262, CGC_SP262
Notes: Made_by: Madl J|"WT Phenotype. Gives dead eggs."

Proper citation: RRID:WB-STRAIN:WBStrain00034182 Copy   


  • RRID:WB-STRAIN:WBStrain00034183

http://www.wormbase.org/db/get?name=WBStrain00034183

Source Database: WormBase (WB)
Availability: available
Source References: PMID:574105
Synonyms: mnDp1(X;V)/+ V; mnDf4 X.
Alternate IDs: WB-STRAIN:SP265, CGC_SP265
Notes: Made_by: Meneely P|"WT PHENOTYPE."

Proper citation: RRID:WB-STRAIN:WBStrain00034183 Copy   


  • RRID:WB-STRAIN:WBStrain00034184

http://www.wormbase.org/db/get?name=WBStrain00034184

Source Database: WormBase (WB)
Availability: available
Source References: PMID:574105
Synonyms: mnDp1(X;V)/+ V; mnDf5 X.
Alternate IDs: WB-STRAIN:SP266, CGC_SP266
Notes: Made_by: Meneely P|"WT PHENOTYPE. Should throw dead eggs."

Proper citation: RRID:WB-STRAIN:WBStrain00034184 Copy   


  • RRID:WB-STRAIN:WBStrain00034186

http://www.wormbase.org/db/get?name=WBStrain00034186

Source Database: WormBase (WB)
Availability: available
Source References: PMID:574105
Synonyms: mnDp1(X;V)/+ V; mnDf7 X.
Alternate IDs: WB-STRAIN:SP268, CGC_SP268
Notes: Made_by: Meneely P|"WT PHENOTYPE. Should throw dead eggs."

Proper citation: RRID:WB-STRAIN:WBStrain00034186 Copy   


  • RRID:WB-STRAIN:WBStrain00034187

http://www.wormbase.org/db/get?name=WBStrain00034187

Source Database: WormBase (WB)
Availability: available
Source References: PMID:574105
Synonyms: mnDp1(X;V)/+ V; mnDf8 X.
Alternate IDs: WB-STRAIN:SP269, CGC_SP269
Notes: Made_by: Meneely P|"WT PHENOTYPE."

Proper citation: RRID:WB-STRAIN:WBStrain00034187 Copy   


  • RRID:WB-STRAIN:WBStrain00034188

http://www.wormbase.org/db/get?name=WBStrain00034188

Source Database: WormBase (WB)
Availability: available
Source References: PMID:574105
Synonyms: mnDp1(X;V)/+ V; mnDf9 X.
Alternate IDs: WB-STRAIN:SP270, CGC_SP270
Notes: Made_by: Meneely P|"WT PHENOTYPE."

Proper citation: RRID:WB-STRAIN:WBStrain00034188 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. Neuroscience Information Framework Resources

    Welcome to the NIF Resources search. From here you can search through a compilation of resources used by NIF and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that NIF has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on NIF then you can log in from here to get additional features in NIF such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into NIF you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within NIF that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X